View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_high_23 (Length: 406)
Name: NF3097_high_23
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_high_23 |
 |  |
|
| [»] scaffold0653 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 2e-90; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 20 - 216
Target Start/End: Complemental strand, 18161461 - 18161265
Alignment:
| Q |
20 |
agtggatggtgttagatcggattgtgtgtggtgtctgaggaaacgagaggtggaggatcacttgttttgtagatgtaacttggttgcggaaatttggtat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
18161461 |
agtggatggtgttagatcggattgtgtgtggtgtccgaggaaacgagaggtggaggatcacttgttttgtcgatgtaacttggtagcggaaatttggtat |
18161362 |
T |
 |
| Q |
120 |
ttgatctttaaatggattggaacggtgtcattctaccatgtggtctccctcatagattatttctcttcttattctttatcaagaaagcaccctaagg |
216 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18161361 |
ttgatctttaaatggattggaatggtgtcattctaccatgtggtctctctcctagattatttctcttcttattctttatcaaaaaagcaccctaagg |
18161265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 234 - 406
Target Start/End: Complemental strand, 18161104 - 18160929
Alignment:
| Q |
234 |
taatgcaggaatttaagaatcagaaacacaataaaatacactgtcagtggagtcaactctt-ctagctacattatattctgcttaattcattctttc--c |
330 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||| | ||||||||||||||||||||||| |||| | |
|
|
| T |
18161104 |
taatgcaggaatttaagaatcagaaatgcaataaaatacactgtcagtggagtcaaccctggctacattcattatattctgcttaattcattatttctcc |
18161005 |
T |
 |
| Q |
331 |
tttcattcagtacataaggtagagaataataagacagcttcctagcaaataacagttgtatgcaatagcctatgat |
406 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||| | ||||||||||||||| |||| ||||||||| |
|
|
| T |
18161004 |
tttcattctgtacataaggtagaaaataataagacagcttccttgaaaataacagttgtatacaattgcctatgat |
18160929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 329
Target Start/End: Complemental strand, 19407263 - 19407206
Alignment:
| Q |
269 |
atacactgtcagtggagtcaactcttctagctacattatattctgcttaattcattctttc |
329 |
Q |
| |
|
|||||||||| |||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
19407263 |
atacactgtccgtggagtcaactctg---gcaacattatattctgcttaattcattatttc |
19407206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 20 - 189
Target Start/End: Complemental strand, 33899194 - 33899020
Alignment:
| Q |
20 |
agtggatggtgttagatcggattgtgtgtggtgtctgaggaaacgagaggtggaggatcacttgttttgtagatgtaacttggttgcggaaatttggtat |
119 |
Q |
| |
|
|||| |||| ||||| | |||||||||||||||| |||||| | |||||| | |||||||||||||| ||||||||||| ||||||||||| || ||| |
|
|
| T |
33899194 |
agtgaatggagttagtttggattgtgtgtggtgtttgaggattcaagaggtaaatgatcacttgttttgcagatgtaactttgttgcggaaatatgatat |
33899095 |
T |
 |
| Q |
120 |
ttgatctttaaatggattggaacggtgtcattctacc-----atgtggtctccctcatagattatttctcttctt |
189 |
Q |
| |
|
| ||| ||||||||||||| ||||| ||||||||||| ||||||| |||||| ||||| |||| ||||||| |
|
|
| T |
33899094 |
tcgatttttaaatggattgtaacggggtcattctaccctaaaatgtggtttccctcctagatcatttatcttctt |
33899020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 56; Significance: 4e-23; HSPs: 10)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 20 - 124
Target Start/End: Complemental strand, 5831693 - 5831587
Alignment:
| Q |
20 |
agtggatggtgttagatcggattgtgtgtggtgtctgaggaaacgagaggtg--gaggatcacttgttttgtagatgtaacttggttgcggaaatttggt |
117 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||| | ||||||| |||||||||||||||||||||| ||| || |||| |||||||| || |
|
|
| T |
5831693 |
agtggatggtgttagttcgaattgtgtgtggtgtctgaggattcaagaggtgtggaggatcacttgttttgtagatctaattttgttgtggaaatttagt |
5831594 |
T |
 |
| Q |
118 |
atttgat |
124 |
Q |
| |
|
||||||| |
|
|
| T |
5831593 |
atttgat |
5831587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 20 - 189
Target Start/End: Complemental strand, 19459533 - 19459358
Alignment:
| Q |
20 |
agtggatggtgttagatcggattgtgtgtggtgtctgaggaaacgagaggtggaggatcacttgttttgtagatgtaacttggttgcggaaatttggtat |
119 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||| |||| |||||||||||||||| ||| ||||||||||||||||| ||| || ||||| ||| |
|
|
| T |
19459533 |
agtggatggtgttagttcggattgtgggtggtgtccaaggattcgagaggtggaggatcgcttattttgtagatgtaacttcactgcagacatttgatat |
19459434 |
T |
 |
| Q |
120 |
ttgatctttaaatggattggaacggtg-tcattctacc-----atgtggtctccctcatagattatttctcttctt |
189 |
Q |
| |
|
| || ||||||||||| ||||||| | |||||||||| ||| || |||||| |||||||||||||||||| |
|
|
| T |
19459433 |
tcaatttttaaatggatcggaacggagatcattctacctagaagtgttgtttccctcctagattatttctcttctt |
19459358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 20 - 189
Target Start/End: Complemental strand, 19557211 - 19557036
Alignment:
| Q |
20 |
agtggatggtgttagatcggattgtgtgtggtgtctgaggaaacgagaggtggaggatcacttgttttgtagatgtaacttggttgcggaaatttggtat |
119 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||| |||| |||||||||||||||| ||| ||||||||||||||||| ||| || ||||| ||| |
|
|
| T |
19557211 |
agtggatggtgttagttcggattgtgggtggtgtccaaggattcgagaggtggaggatcgcttattttgtagatgtaacttcactgcagacatttgatat |
19557112 |
T |
 |
| Q |
120 |
ttgatctttaaatggattggaacggtg-tcattctacc-----atgtggtctccctcatagattatttctcttctt |
189 |
Q |
| |
|
| || ||||||||||| ||||||| | |||||||||| ||| || |||||| |||||||||||||||||| |
|
|
| T |
19557111 |
tcaatttttaaatggatcggaacggagatcattctacctagaagtgttgtttccctcctagattatttctcttctt |
19557036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 23 - 143
Target Start/End: Original strand, 19403254 - 19403373
Alignment:
| Q |
23 |
ggatggtgttagatcggattgtgtgtggtgtctgaggaaacgagaggtggaggatcacttgttttgtagatgtaacttggttgcggaaatttggtatttg |
122 |
Q |
| |
|
|||||||||||| | ||| ||||||||||||| || | |||||| |||||||||||||||||||||||| |||||| |||| || |||||||||| | |
|
|
| T |
19403254 |
ggatggtgttagtttggaatgtgtgtggtgtcctagaattcgagagctggaggatcacttgttttgtagat-taacttcattgcagacatttggtattcg |
19403352 |
T |
 |
| Q |
123 |
atctttaaatggattggaacg |
143 |
Q |
| |
|
|| ||||||||||| |||||| |
|
|
| T |
19403353 |
atttttaaatggatcggaacg |
19403373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 20 - 106
Target Start/End: Original strand, 19409181 - 19409267
Alignment:
| Q |
20 |
agtggatggtgttagatcggattgtgtgtggtgtctgaggaaacgagaggtggaggatcacttgttttgtagatgtaacttggttgc |
106 |
Q |
| |
|
|||||||||||||| || || | ||||||||||| |||| ||||||||| |||||||||||||||||||| ||||||| ||||| |
|
|
| T |
19409181 |
agtggatggtgttatttcagactctgtgtggtgtcctaggattcgagaggtgaaggatcacttgttttgtagaagtaacttcgttgc |
19409267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 20 - 106
Target Start/End: Original strand, 19456200 - 19456286
Alignment:
| Q |
20 |
agtggatggtgttagatcggattgtgtgtggtgtctgaggaaacgagaggtggaggatcacttgttttgtagatgtaacttggttgc |
106 |
Q |
| |
|
|||||||||||||| || || | ||||||||||| |||| ||||||||| |||||||||||||||||||| ||||||| ||||| |
|
|
| T |
19456200 |
agtggatggtgttatttcagactctgtgtggtgtcctaggattcgagaggtgaaggatcacttgttttgtagaagtaacttcgttgc |
19456286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 20 - 106
Target Start/End: Complemental strand, 19524877 - 19524791
Alignment:
| Q |
20 |
agtggatggtgttagatcggattgtgtgtggtgtctgaggaaacgagaggtggaggatcacttgttttgtagatgtaacttggttgc |
106 |
Q |
| |
|
|||||||||||||| || || | ||||||||||| |||| ||||||||| |||||||||||||||||||| ||||||| ||||| |
|
|
| T |
19524877 |
agtggatggtgttatttcagactctgtgtggtgtcctaggattcgagaggtgaaggatcacttgttttgtagaagtaacttcgttgc |
19524791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 20 - 106
Target Start/End: Complemental strand, 19471166 - 19471082
Alignment:
| Q |
20 |
agtggatggtgttagatcggattgtgtgtggtgtctgaggaaacgagaggtggaggatcacttgttttgtagatgtaacttggttgc |
106 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| |||| | |||||| ||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
19471166 |
agtggatggtgttatttcagattgtgtgtggtgtcctaggattc--gaggtgaaggatcacttgctttgtagacgtaacttcgttgc |
19471082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 20 - 106
Target Start/End: Complemental strand, 19542090 - 19542006
Alignment:
| Q |
20 |
agtggatggtgttagatcggattgtgtgtggtgtctgaggaaacgagaggtggaggatcacttgttttgtagatgtaacttggttgc |
106 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| |||| | |||||| ||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
19542090 |
agtggatggtgttatttcagattgtgtgtggtgtcctaggattc--gaggtgaaggatcacttgctttgtagacgtaacttcgttgc |
19542006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 20 - 106
Target Start/End: Original strand, 19590607 - 19590691
Alignment:
| Q |
20 |
agtggatggtgttagatcggattgtgtgtggtgtctgaggaaacgagaggtggaggatcacttgttttgtagatgtaacttggttgc |
106 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| |||| | |||||| ||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
19590607 |
agtggatggtgttatttcagattgtgtgtggtgtcctaggattc--gaggtgaaggatcacttgctttgtagacgtaacttcgttgc |
19590691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 7e-22; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 20 - 120
Target Start/End: Complemental strand, 6796572 - 6796471
Alignment:
| Q |
20 |
agtggatggtgttagatcggattgtgtgtggtgtctgaggaaa-cgagaggtggaggatcacttgttttgtagatgtaacttggttgcggaaatttggta |
118 |
Q |
| |
|
||||| ||||||| | ||||||| |||||||||| || || | |||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6796572 |
agtgggtggtgtttgttcggattatgtgtggtgtatgggggattcgagagatggaggatcacttgttttgtagatgtaactttgttgcggaaatttggta |
6796473 |
T |
 |
| Q |
119 |
tt |
120 |
Q |
| |
|
|| |
|
|
| T |
6796472 |
tt |
6796471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 65 - 114
Target Start/End: Original strand, 7441269 - 7441318
Alignment:
| Q |
65 |
agaggtggaggatcacttgttttgtagatgtaacttggttgcggaaattt |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
7441269 |
agaggtggagaatcacttgttttgtagatgtaactttgttatggaaattt |
7441318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 65 - 93
Target Start/End: Complemental strand, 33823179 - 33823151
Alignment:
| Q |
65 |
agaggtggaggatcacttgttttgtagat |
93 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33823179 |
agaggtggaggatcacttgttttgtagat |
33823151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0653 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0653
Description:
Target: scaffold0653; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 65 - 95
Target Start/End: Original strand, 964 - 994
Alignment:
| Q |
65 |
agaggtggaggatcacttgttttgtagatgt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
964 |
agaggtggaggatcacttgttttgtagatgt |
994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 65 - 95
Target Start/End: Complemental strand, 9287353 - 9287323
Alignment:
| Q |
65 |
agaggtggaggatcacttgttttgtagatgt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9287353 |
agaggtggaggatcacttgttttgtagatgt |
9287323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 65 - 95
Target Start/End: Complemental strand, 9297145 - 9297115
Alignment:
| Q |
65 |
agaggtggaggatcacttgttttgtagatgt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9297145 |
agaggtggaggatcacttgttttgtagatgt |
9297115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 65 - 95
Target Start/End: Complemental strand, 35752722 - 35752692
Alignment:
| Q |
65 |
agaggtggaggatcacttgttttgtagatgt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35752722 |
agaggtggaggatcacttgttttgtagatgt |
35752692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University