View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_high_29 (Length: 386)
Name: NF3097_high_29
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_high_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 88 - 379
Target Start/End: Original strand, 404035 - 404326
Alignment:
| Q |
88 |
gttgttcaactgtgattaatctctgaattttcaggtaaacggcatagttctgcagatcttttacgatatgcacgacattccaatctcagaattgcggtct |
187 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||| || || | |
|
|
| T |
404035 |
gttgttcaactgggactaatctctgaattttcaggtaaacgacatagttctgcggatcttttacgatatgcgcgacattccaatctcagaatcgccgttt |
404134 |
T |
|
| Q |
188 |
atgctagtgtggaaagactccttctagcatcttcttcatcttcttatgcaccaaattctgcaataagttcttctgttattggtgttctttatcgtgatca |
287 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
404135 |
atgctagcgtggaaagactccttctagcatcttcttcatcttcttttgcaccaaattctgcaacaggttcttctgttattggtgttctttatcgtgatca |
404234 |
T |
|
| Q |
288 |
aaacggtagatatcatcacgcgattttgaaagattttggtgaagtgattctttcagcaggtgcaattggaagtccacagcttcttcatctca |
379 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
404235 |
aaacggtagatatcatcatgcgatgttgaaagattttggtgaagtgatactttcagcaggtgcaattggaagtccacagcttcttcttctca |
404326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 403952 - 404011
Alignment:
| Q |
1 |
gagattagggttgaacttacggcagccttgc---taatatttaattccacctgcactttt |
57 |
Q |
| |
|
||||||||||| ||||||| || |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
403952 |
gagattagggtggaacttatggtagccttgctaataatatttaattccgcctgcactttt |
404011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University