View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_high_32 (Length: 357)
Name: NF3097_high_32
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_high_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 58 - 345
Target Start/End: Original strand, 54918074 - 54918368
Alignment:
| Q |
58 |
gtggaagtttgtgcttgctacctagtcaaaacaaccctagtataatctcatataaaagttccagcttgaataaggtcccaaagacacaatggatttataa |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54918074 |
gtggaagtttgtgcttgctacctagtcaaaacaaccctagtataatctcatataagagttccagcttgaataaggtcccaaagacacaatggatttat-- |
54918171 |
T |
|
| Q |
158 |
tgttcgtctcatttggctttatttccatttgatctcatgctttcgtcactaaattcctctatgttttgtgccacctttaaattcatgcatcaaaacaaac |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
54918172 |
-gttcgtctcatttggctttatttccatttgatctcatgctttcgtcactaaattcctctatgttttgtgtcacctttaaattcatgcatcaaaacaaac |
54918270 |
T |
|
| Q |
258 |
aaatttttattcccatatcttcttcttaagcc----------atagaaaaagtgcatattacctttttggtgagtaaaaggtagagaagagctttttg |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54918271 |
aaatttttattcccatatcttcttcttaagccatagaaagggatagaaaaagtgcatattacctttttggtgagtaaaaggtagaggagagctttttg |
54918368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 11 - 59
Target Start/End: Original strand, 54917989 - 54918037
Alignment:
| Q |
11 |
cagagacagatcaccccattgttcatcccatctagtattcaaaaatcgt |
59 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54917989 |
cagagacaaatcaccccattgttcatcccacctagtattcaaaaatcgt |
54918037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 273 - 322
Target Start/End: Complemental strand, 54911684 - 54911635
Alignment:
| Q |
273 |
tatcttcttcttaagccatagaaaaagtgcatattacctttttggtgagt |
322 |
Q |
| |
|
||||||||||| ||||| |||||||||| ||| |||||||||||||||| |
|
|
| T |
54911684 |
tatcttcttctaaagccctagaaaaagtatatagtacctttttggtgagt |
54911635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 173 - 217
Target Start/End: Complemental strand, 54911789 - 54911745
Alignment:
| Q |
173 |
gctttatttccatttgatctcatgctttcgtcactaaattcctct |
217 |
Q |
| |
|
||||||||||||||||||| |||||| || ||| ||||||||||| |
|
|
| T |
54911789 |
gctttatttccatttgatcccatgctctcctcattaaattcctct |
54911745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University