View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_high_4 (Length: 543)
Name: NF3097_high_4
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 458; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 458; E-Value: 0
Query Start/End: Original strand, 24 - 540
Target Start/End: Complemental strand, 22512552 - 22512035
Alignment:
| Q |
24 |
cttctctgtcataagaccgctcaaactcatcacactgaaatcaccttcgtcctcattttcttcctccattgcagctactaaagcttgagcctcaacctcc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22512552 |
cttctctgtcataagaccgctcaaactcatcacactcaaatcaccttcgtcctcattttcttcctccgttgcagctactaaagcttgagcctcaacctcc |
22512453 |
T |
 |
| Q |
124 |
tcttcgtcgtcttcctctgtcaccataatgagtaactgccggtccgggcactggtgacggggg-tgagagttgccacctcaccggaaacacagtccacgt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22512452 |
tcttcgtcgtcttcctctgtcaccataatgcgtaactgccggtccgggcactggtgacggggggtgagagttgccaccgcaccggaaacacagtccacgt |
22512353 |
T |
 |
| Q |
223 |
ctttgaaacactcccacgttaggtttccttcatcattggttaacgccttgaagaagtgtatggtcgaaccctctatacataattgtgctaaattcacctt |
322 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22512352 |
ctttgaaacgctcccacgttaggtttccttcatcattggttaacgccttgaagaagtgtatggtcgaaccctctatacataattgtgctaaattcacctt |
22512253 |
T |
 |
| Q |
323 |
caattcttaattggtattttgcacgcgaaaatagatcttggcgcgagtgatccacccagctgggtcatcgccggtgaacatagacaattccactttcttt |
422 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
22512252 |
caattcttaattggtattttgcacgcgaaaatagatcttggcgcgagtgatccacccagctgggtcatcgccggcgaacataggcaattccactttcttc |
22512153 |
T |
 |
| Q |
423 |
acaaatctgcggaattcttccaagttgtttccggtgaatgatttcttcatcttggttttatcatcactgacgtcacccatgtccttttccttcactacag |
522 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22512152 |
acagatctgctgaattcttccaagttgtttccggtgaacgatttcttcatctcggttttatcatcactgacgtcacccatgtccttttccttcactacag |
22512053 |
T |
 |
| Q |
523 |
acttccctttgctactcc |
540 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
22512052 |
acttcccttagctactcc |
22512035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University