View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_high_51 (Length: 282)
Name: NF3097_high_51
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_high_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 12 - 143
Target Start/End: Complemental strand, 39511384 - 39511254
Alignment:
| Q |
12 |
atgaatacaagatcttcttatagtagggattccaaatttgtgtttagatttgcgttgtagttataattcttgctttcttatgactaaaacttcaaaacta |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| || |
|
|
| T |
39511384 |
atgaatacaagatcttcttatagtagggatttcaaatttgtgtttagatttgcgttgtagttataattcttgcttttttatgactaaaacttc-aaatta |
39511286 |
T |
 |
| Q |
112 |
aattcgtgtttgaattttgcgttatgttttgg |
143 |
Q |
| |
|
|||| |||||||||||||||||| | |||||| |
|
|
| T |
39511285 |
aatttgtgtttgaattttgcgttctattttgg |
39511254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 167 - 257
Target Start/End: Complemental strand, 39511195 - 39511107
Alignment:
| Q |
167 |
ttgatcgttgcatattcgaagggactcacaccatggtttcatatgtaagctcacgcttatgatgcatgtgggttaagagggattcatacct |
257 |
Q |
| |
|
||||| ||||||| |||||||||| |||| ||||||||||||||||||||| ||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
39511195 |
ttgatggttgcatgttcgaagggattcac--catggtttcatatgtaagctcgcgcttatgacgcatgtgggttgagagggattcatacct |
39511107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University