View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_high_63 (Length: 252)
Name: NF3097_high_63
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_high_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 12 - 233
Target Start/End: Original strand, 44576104 - 44576321
Alignment:
| Q |
12 |
tcatcaaacccaaatactgtattaaaatatccacttggaattttcccaggtattgaactcttcctattgaataactctgacatctaaca-tcaaaatgtt |
110 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44576104 |
tcatcaaacccaaatactgtattgaaatatccacttggaattttcccaggtatcgaactcttcctattgaataactctgacatctaacattcaaaatgtt |
44576203 |
T |
 |
| Q |
111 |
gagttaacatcaagttaattcgatcggttgaaaggttagtaaagtctatcacatatataatgattgatatgaaatgagtgaattagctttagcttacttg |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44576204 |
gagttaacatcaag----ttcgatcggttgaaaggttagtaaagtctatcacatatataatgattgatatgaaatgagtgaattagc-ttagcttacttg |
44576298 |
T |
 |
| Q |
211 |
ggtgaaggtgaggatgtcggatt |
233 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44576299 |
ggtgaaggtgaggatgtcggatt |
44576321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University