View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_high_64 (Length: 251)
Name: NF3097_high_64
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_high_64 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 251
Target Start/End: Original strand, 2389011 - 2389244
Alignment:
| Q |
18 |
catactgctagaatcgagataaactcgatccacctgacataaataagaagacattagcatgttggtaaaatttcaaggattgccgattaatttaacttat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2389011 |
catactgctagaatcgagataaactcgatccacctaacacaaataagaagacattagcatgttggtaaaatttcaaggattgccgattaatttaacttac |
2389110 |
T |
|
| Q |
118 |
aaatataaggatgggcttggattaaaatcatcaactgcctcacctcagattcaaatgttaaagcatctccttgttcggtgaagcgttccttctggtgtag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2389111 |
aaatataaggatgggcttggattaaaatcatcaactgcctcacctcagattcaaatgttaaagcatctccttgttcagtgaagcgttccttctggtgtag |
2389210 |
T |
|
| Q |
218 |
gttatccagatagtcaagagtttccaacccttct |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2389211 |
gttatccagatagtcaagagtttccaacccttct |
2389244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University