View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_high_65 (Length: 251)
Name: NF3097_high_65
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_high_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 11 - 223
Target Start/End: Complemental strand, 47083377 - 47083162
Alignment:
| Q |
11 |
cagagaagtagatgtattttcttctgtgtcgttattgtaattgtaattggagggctccaaaaaaccatgataggaaaggacaatgagaaacacacaacca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47083377 |
cagagaagtagatgtattttcttctgtgtcgttattgtaattg------gagggctccaaaaaaacatgataggaaaggacaatgagaaacacacaacca |
47083284 |
T |
 |
| Q |
111 |
aacaaagaacataatccaaatacaggcagagttattgat---------gcagaatctcgggctaaattacaaagcccagattagggagatgtgaaagttc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47083283 |
aacaaagaacataatccaaatacaggcagagttattgatgcagcagtagcagaatctcgggctaaattacaaagcccagattagggagatgtgaaagttc |
47083184 |
T |
 |
| Q |
202 |
atatgaaaccaacccaacccaa |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
47083183 |
atatgaaaccaacccaacccaa |
47083162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University