View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_high_79 (Length: 241)
Name: NF3097_high_79
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_high_79 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 13 - 223
Target Start/End: Complemental strand, 488577 - 488367
Alignment:
| Q |
13 |
atgaaatgaaaagatgcatacatttggggattttgggattgtgagagcaggaggggcaaaaccaagaggatttagggacggaagggaggataggagtgag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488577 |
atgaaatgaaaagatgcatacatttggggattttgggattgtgagagcaggaggggcaaaaccaagaggatttagggacggaagggaggataggagtgag |
488478 |
T |
 |
| Q |
113 |
gcagaagagatgatagccgttgtcgcaattgtcgcagagaagcaacttagttggggatttgccggagttgcatttctggcaaactacgtcgtcgtcgttg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488477 |
gcagaagagatgatagccgttgtcgcaattgtcgcagagaagcaacttagttggggatttgccggagttgcatttctggcaaactacgtcgtcgtcgttg |
488378 |
T |
 |
| Q |
213 |
ttgttgaaggt |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
488377 |
ttgttgaaggt |
488367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 111 - 205
Target Start/End: Complemental strand, 500576 - 500482
Alignment:
| Q |
111 |
aggcagaagagatgatagccgttgtcgcaattgtcgcagagaagcaacttagttggggatttgccggagttgcatttctggcaaactacgtcgtc |
205 |
Q |
| |
|
|||||||||||||| ||||| |||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
500576 |
aggcagaagagatggtagcctttgttgcaattgtcgcaaagaagcaacttggttggggatttgccggagttgcatttctggcaaacaatgtcgtc |
500482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 51 - 96
Target Start/End: Complemental strand, 500624 - 500579
Alignment:
| Q |
51 |
ttgtgagagcaggaggggcaaaaccaagaggatttagggacggaag |
96 |
Q |
| |
|
||||| ||||| |||||||||||||| |||||||| |||||||||| |
|
|
| T |
500624 |
ttgtgggagcaagaggggcaaaaccacgaggatttcgggacggaag |
500579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University