View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_high_93 (Length: 228)
Name: NF3097_high_93
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_high_93 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 5 - 222
Target Start/End: Original strand, 20056904 - 20057123
Alignment:
| Q |
5 |
gttacccaaactcctgctgtaatttatgacaatatttctccatcacaatggaaatacttctccattcttcttaggaaactaaaaatgggtgatggaaatc |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20056904 |
gttactcaaactcctgctgtaatttatgacaatatttcaccatcacaatggaaatacttctccattcttcttaggaaactaaaaatgggtgatggaaatc |
20057003 |
T |
|
| Q |
105 |
tagaaaaaacaaccaaagatgcagcttgagaaggttataacaacggt--nnnnnnnnnncaccgcgcaaactaagaagaagaaagataaggccacaaact |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20057004 |
tagaaaaaacaaccaaagatgcagcttgagaaggttataacaacggtaaaaaaaaaaaacaccgcgcaaactaagaagaagaaagataaggccacaaact |
20057103 |
T |
|
| Q |
203 |
ctctatggtataagtcttat |
222 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
20057104 |
ctctatggtataagtcttat |
20057123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University