View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_high_95 (Length: 227)
Name: NF3097_high_95
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_high_95 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 107 - 227
Target Start/End: Original strand, 29176001 - 29176121
Alignment:
| Q |
107 |
aattaaattaattcttgttctttattaagagtaaattgaggtgatgatagcaactataatgcctataatcccaatctgcatgatactttttagtgtgtgc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29176001 |
aattaaattaattcttgttctttattaagagtaaattgaggtgatgatagcaaatataatgcctataatcccaatctgcatgatactttttagtgcgtgc |
29176100 |
T |
|
| Q |
207 |
tttgatatgaaaataatgatt |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29176101 |
tttgatatgaaaataatgatt |
29176121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 5 - 82
Target Start/End: Original strand, 29175860 - 29175937
Alignment:
| Q |
5 |
cacataacatgtttctttgtgtcagattctttgaatttatgcttgatgcatcaatttttcagtttgctattatcgttg |
82 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29175860 |
cacatgacatgtttctttgtgtaagattctttgaatttatgcttgatgcatcaatttttcagtttgctattatcgttg |
29175937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University