View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_high_98 (Length: 218)
Name: NF3097_high_98
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_high_98 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 201
Target Start/End: Complemental strand, 42837316 - 42837128
Alignment:
| Q |
13 |
gagaagaaacaaaattaggtataacagattgtacagaagaaagcatgtccatgtgcgacttgtgttgagtttctatgcgagctttaagactgtttatacc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42837316 |
gagaagaaacaaaattaggtataacagattgtacagaagaaagcatgtacatgtgcgacttgtgttgagtttctatgcgagctttaagactgtttatacc |
42837217 |
T |
|
| Q |
113 |
ttcatctgtctccatctccattgatgatgaatgattgattccgatcagatcaattctccaagcagtgcagcgatcttcaggttactggt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42837216 |
ttcatctgtctccatctccattgatgatgaatgattgattccgatcagatcaattctccaagcagtgcagcgatcttcaggttactggt |
42837128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 13 - 96
Target Start/End: Original strand, 43914996 - 43915079
Alignment:
| Q |
13 |
gagaagaaacaaaattaggtataacagattgtacagaagaaagcatgtccatgtgcgacttgtgttgagtttctatgcgagctt |
96 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
43914996 |
gagaagaaacaagattaggtataacggattgtacagaagaaagcatgtccatgtgtgacttgtgttgggtttctatgcgagctt |
43915079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 101 - 152
Target Start/End: Original strand, 43915105 - 43915156
Alignment:
| Q |
101 |
actgtttataccttcatctgtctccatctccattgatgatgaatgattgatt |
152 |
Q |
| |
|
|||||||| |||||||||||||||||| | ||| ||||||||||||| |||| |
|
|
| T |
43915105 |
actgtttaaaccttcatctgtctccatgttcatggatgatgaatgatggatt |
43915156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University