View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_low_101 (Length: 230)
Name: NF3097_low_101
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_low_101 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 211
Target Start/End: Complemental strand, 43299369 - 43299177
Alignment:
| Q |
19 |
tattgttggaacaataatgttctaacatgtatgtcactagataagctcaaagacgtcaatctaaaccggccctcagtagaaagacatgtgcataagctgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43299369 |
tattgttggaacaataatgttctaacatgtacgtcactagataagctcaaagacgtcaatctaaaccggccctcagtagaaagacatgtgcataagctgt |
43299270 |
T |
 |
| Q |
119 |
tttcaatcaatttcatagcctaatttagaaagaaacacttaactataacgtatagaataagggcgtaattgaaaagtttgattctttcttgtg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43299269 |
tttcaatcaatttcatagcctaatttagaaagaaacacttaactataacgtatagaataagggcgtaattgaaaagtttgattctttcttgtg |
43299177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University