View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_low_112 (Length: 212)
Name: NF3097_low_112
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_low_112 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 23 - 195
Target Start/End: Original strand, 39073306 - 39073478
Alignment:
| Q |
23 |
tcttcatcaggttcactcagtgacatcttagggatccatcgaatcgaagacgtagaagaacaagaagaagagttaggagctatgaaggaaatgatgtaca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39073306 |
tcttcatcaggttcactcagtgacatcttagggatccatcgaatcgaagacgtagaagaacaagaagaagagttaggagctatgaaggaaatgatgtaca |
39073405 |
T |
|
| Q |
123 |
agattgcagctatgcaaccggtggacatcgacccagcaacgattcgaaaaccaaaacgaagaaacgttcgaat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39073406 |
agattgcagctatgcaaccggtggacatcgacccagcaacgattcgaaaaccaaaacgaagaaacgttcgaat |
39073478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University