View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_low_114 (Length: 204)
Name: NF3097_low_114
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_low_114 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 182
Target Start/End: Original strand, 33771912 - 33772076
Alignment:
| Q |
18 |
agagaaaagtttttgtttgctcagctatgtcatccacacccttcatcaacgccgacccaaaactacgcttaaattctccctcctcgattgcaatggattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33771912 |
agagaaaagtttttgtttgctcagctatgtcatccacacccttcatcaacgccgacccaaaactacgctttaattctccctcctcgattgcaatggattt |
33772011 |
T |
 |
| Q |
118 |
tgacagagatgtaccacaaaccccttccctttaaccttcaagtagacaatttaattttccatata |
182 |
Q |
| |
|
||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33772012 |
tgaaagagatgtaccacaaaccccctccctttaaccttcaagtagacaatttaattttccatata |
33772076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University