View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_low_20 (Length: 434)
Name: NF3097_low_20
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 260; Significance: 1e-145; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 17 - 331
Target Start/End: Complemental strand, 45521027 - 45520713
Alignment:
| Q |
17 |
agtttcgacttgaatattatttcctttgtttcttgtttagatgatgccatttaattgaatgatcaatgaagaagaagaagatgtgaaattgtatctaatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45521027 |
agtttcgacttgaatattatttcctttgtttcttgtttagatgatgccatttaattgaatgatcaatgaagaagaagaagatgtgaaattgtatctaatc |
45520928 |
T |
|
| Q |
117 |
ttcttctaacttgttcaaatattggaaaccccgacaca--acaacagaacaagtaaataaccaatgcttgcttgcttgcttgctttagagttttaattaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||||| ||| |||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45520927 |
ttcttctaacttgttcaaatattggaaacccctacacaacacaacacaactagtaaacaaccaa----tgcttgcttgcttgctttagagttttaattaa |
45520832 |
T |
|
| Q |
215 |
taatgtttatt--tatatataatagcaaaggattacggctccgcaattgttgttggtgaggggcaaatttgggatttacggaaatgaaaacaattattta |
312 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45520831 |
taatgtttatttatatatataatagcaaaggattacggctccgcaattgttgttggtgaggggcaaatttgggatttacggaaataaaaacaattattta |
45520732 |
T |
|
| Q |
313 |
tacccataaaagttggtga |
331 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
45520731 |
tacccataaaagttggtga |
45520713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 342 - 419
Target Start/End: Complemental strand, 45520679 - 45520605
Alignment:
| Q |
342 |
gtcaatgagatcaaatcc---aaatttatgaggtcgggtttgggttccttctaaacccacccgatccatgatgcttttctt |
419 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
45520679 |
gtcaatgagatcaaatcctccaaatttattaggtcgggtt------ccctctaaacccacccgatccatgatgcttttctt |
45520605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University