View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_low_31 (Length: 392)
Name: NF3097_low_31
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_low_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 1 - 376
Target Start/End: Original strand, 41581270 - 41581645
Alignment:
| Q |
1 |
aagaagagttgatgataactactggcaacttatatatttgatagaacaacatgattcatactcaattatgcagatagttgtacatattatcagaaaggac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41581270 |
aagaagagttgatgataactactggcaacttatatatttgatagaacaacatgattcatactcaattatgcagatagttgtacatattatcagaaaggac |
41581369 |
T |
|
| Q |
101 |
gaaggaaaaattcaaccaaaggtatagagagtgtgcaaagatgatagaaatcaagtgtagagtattcaacaggttttgaagtatgaatgactagcattgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41581370 |
gaaggaaaaattcaaccaaaggtatagagagtgtgcaaagatgatagaaatcaagtgtagagtattcaacaggttttgaagtatgaatgactagtattgc |
41581469 |
T |
|
| Q |
201 |
tggaaatgattgcaatatttttgctatgaaggtattagagagattcaacagggatcatgagcaataataaaaattccttaagtaaaagtaatcaatatca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41581470 |
tggaaatgattgcaatatttttgctatgaaggtattagagagattcaacagggatcatgagcaataataaaaattccttaagtaaaagtaatcaatatca |
41581569 |
T |
|
| Q |
301 |
aaactataagatagtatgcggtgtagtggaactaaagaagagacaaaaccctaagtttatccagtctaaaaccaat |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41581570 |
aaactataagatagtatgcggtgtagtggaactaaagcagagacaaaaccctaagtttatccagtctaaaaccaat |
41581645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University