View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_low_33 (Length: 386)
Name: NF3097_low_33
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 20 - 281
Target Start/End: Original strand, 5149391 - 5149652
Alignment:
| Q |
20 |
tgacattgctctaaaagtatttatggctccactaatgattataagaatcacttcttgtcaacttggttaacttcttgccaacttgatctacttgttcggc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5149391 |
tgacattgctctaaaagtatttatggctccactaatgattataagaatcacttcttgtcaacttggttaacttcttgccaacttgatctacttgttcggc |
5149490 |
T |
 |
| Q |
120 |
gattttgctgcaaatatgtgatgattacatgattttcttcgaacaaattgattagtcaatgactgtgagagaacaatttgggattttttttcttttnnnn |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5149491 |
gattttgctgcaaatatgtgatgattacatgattttcttcgaacaaattgattagtcaatgactgtgagagaacaatttgggatttttttcttttaaaaa |
5149590 |
T |
 |
| Q |
220 |
nnnnnnnntgggatttttggcttcgtgtgttgaactcaaaattgataaattaatgagtcaac |
281 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5149591 |
aaaaaaattgggatttttggcttcgtgtgtttaactcaaaattgataaattaatgagtcaac |
5149652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University