View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_low_38 (Length: 353)
Name: NF3097_low_38
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 12844553 - 12844663
Alignment:
| Q |
1 |
aaaagaatacaaaaaagtggtgatgagcatgttgaagatttatcttgatagattttattgatgcttttattttgagttggacttatgctttgaagaaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12844553 |
aaaagaatacaaaaaagtggtgatgagcatgttgaatatttatcttgatagattttattgatgcttttattttgagttggacttatgctttgaagaaagg |
12844652 |
T |
|
| Q |
101 |
gaaaagaagaa |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
12844653 |
gaaaagaagaa |
12844663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 182 - 239
Target Start/End: Original strand, 12844734 - 12844794
Alignment:
| Q |
182 |
cattttgtgagttggatcatgtact---gttctatgttttgaagaatgagagatgaagcaa |
239 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12844734 |
cattttgtgagttggatcatgtactactgttctatgttttgaagaatgagagatgaagcaa |
12844794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University