View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_low_45 (Length: 331)
Name: NF3097_low_45
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_low_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 48 - 254
Target Start/End: Original strand, 3037621 - 3037826
Alignment:
| Q |
48 |
ttaacaattgtagtactagactactagcttacttagtatagtgaaagccgtggccaatgggcttccattagactggcccacttagagacaatccaatcca |
147 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3037621 |
ttaaaaattgtagtactagactactagcttacttagtatagtgaaagccgtggccaatgggcttccattagactggcccacttagagacaatccaatcca |
3037720 |
T |
|
| Q |
148 |
actgtcacccgcgttcacgtgtcacatacgtggggatgttcttcatgcgacctcatcaataagctatataataaactccacacacactctcacttcctca |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3037721 |
actgtcacccgcgttcacgtgtcacatacgtggggatgttcttcatgcgacctcatcaataagctatataataaactccacacacactctcacttcc-ca |
3037819 |
T |
|
| Q |
248 |
gtagcca |
254 |
Q |
| |
|
||||||| |
|
|
| T |
3037820 |
gtagcca |
3037826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 287 - 320
Target Start/End: Original strand, 3037850 - 3037883
Alignment:
| Q |
287 |
tcccaatctaaattcgaaaaatggatttcttcat |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3037850 |
tcccaatctaaattcgaaaaatggatttcttcat |
3037883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University