View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_low_59 (Length: 266)
Name: NF3097_low_59
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_low_59 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 232
Target Start/End: Original strand, 51005487 - 51005705
Alignment:
| Q |
14 |
acatgtaattatttgtggtggagtgcaatgaaaatgatttcattgttaaacaaattgtcaaaataagatttttgcatgcgtatatcatgcaagtctctag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51005487 |
acatgtaattatttgtggtggagtgcaatgaaaatgatttcattgttaaacaaattgtcaaaataagatttttgcatgcgtatatcatgcaagtctctag |
51005586 |
T |
|
| Q |
114 |
gaagcgtctttttcacgatgccgtaaatttttggaccattttaaaatacgcctacctataaaatattgcataagtcaataatataactaaaaatgatatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51005587 |
gaagcgtctttttcacgatgccgtaaatttttggaccattttaaaatacgcctacctataaaatattgcataagtcaataatataactaaaaatgatatt |
51005686 |
T |
|
| Q |
214 |
tcatccatgtcactttgtc |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
51005687 |
tcatccatgtcactttgtc |
51005705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University