View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_low_60 (Length: 263)
Name: NF3097_low_60
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_low_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 95 - 245
Target Start/End: Original strand, 36671794 - 36671944
Alignment:
| Q |
95 |
cagtgattagtgagaaggttactcgttctgctaagctatggctatcagtagcttgacctcgtcgaacgcgaacatgaacatagggaagcttctcaccggc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36671794 |
cagtgattagtgagaaggttactcgttctgctaagctatggctatcagtagcttgacctcgtcgaacgcgaacatgaacatagggaagcttctcaccggc |
36671893 |
T |
 |
| Q |
195 |
accggaagtttcatcggcgatgcttttgctcttcttcgacgacgacgcttt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36671894 |
accggaagtttcatcggcgatgcttttgctcttcttcgacgacgacgcttt |
36671944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 120 - 184
Target Start/End: Complemental strand, 21509085 - 21509021
Alignment:
| Q |
120 |
ttctgctaagctatggctatcagtagcttgacctcgtcgaacgcgaacatgaacatagggaagct |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
| T |
21509085 |
ttctgctaagctatggctatcagtagcttgacctcgtcgaactcgaacgtgaacgtacggaagct |
21509021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University