View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_low_66 (Length: 254)
Name: NF3097_low_66
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_low_66 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 3959600 - 3959853
Alignment:
| Q |
1 |
cttttcctctcaaatttccatttcctcctttttgtaaaaacctaaataagaaaaaccccaatgaggtggtccagaatttttcgttcattcatgtttggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| ||||| |
|
|
| T |
3959600 |
cttttcctctcaaatttccatttcctcctttttgtaaaaacctaaataagaaaaaccccaatgatgtggtccagaattttttgttcattcatgtatggaa |
3959699 |
T |
|
| Q |
101 |
acccgaatgactataataaccgctagaaacccttcacaatgtggaaattggcagcaaaacattggtttcaaaattattttggtacatatatatgcccttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3959700 |
acccgaatgactataataaccgctagaaaccctttacaatgtggaaattggcagcaaaacattggtttcaaaattattttggtacatatatatgcccttt |
3959799 |
T |
|
| Q |
201 |
atcgttggtgaaacttatagagtaaatatatcccttcttttctgctcctaattc |
254 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3959800 |
atcgttggtgaaacttatatagtaaatatatcccttcttttctgctcctaattc |
3959853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 96 - 161
Target Start/End: Complemental strand, 4021260 - 4021195
Alignment:
| Q |
96 |
tggaaacccgaatgactataataaccgctagaaacccttcacaatgtggaaattggcagcaaaaca |
161 |
Q |
| |
|
||||||||| ||||||| ||| |||| | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
4021260 |
tggaaaccctaatgactctaacaaccaccagaaacccttcaggttgtggaaattggcagcaaaaca |
4021195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University