View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_low_75 (Length: 250)
Name: NF3097_low_75
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_low_75 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 13 - 160
Target Start/End: Original strand, 45041327 - 45041470
Alignment:
| Q |
13 |
aatattacaaatacaatctcaatatatcacaaaaattaataagatcaatgaacaattgatgctacggattaggattgtgtccagtgtgacggtacaaagt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| ||||| ||||||||||||||||| ||||| ||| |
|
|
| T |
45041327 |
aatattacaaatacaatctcaatatatcacaaaaat----aagatcaatgaacaattgatactacaaattagaattgtgtccagtgtgactgtacacagt |
45041422 |
T |
|
| Q |
113 |
aaattacatctaaactgtctaatcagatttcaatgcagatttaacttc |
160 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45041423 |
aaattacatctaaaccgtctaatcagatttcaatgcagatttaacttc |
45041470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 204 - 249
Target Start/End: Original strand, 45041471 - 45041516
Alignment:
| Q |
204 |
tttaggagtctttggattgtgaccgcacacgacccaaacattgatg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
45041471 |
tttaggagtctttggattgtgaccgcacacggcccagacattgatg |
45041516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University