View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_low_81 (Length: 247)
Name: NF3097_low_81
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_low_81 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 2 - 240
Target Start/End: Original strand, 7290258 - 7290496
Alignment:
| Q |
2 |
tattcttgatgcaagttgatgataatcgtcttttggtatgttgggcagaattatgcacaaacatactttaggtaaaataaacttatcttttatgtcttgc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
7290258 |
tattcttgatgcaagttgatgataatcgtcttttggtatgtttggcagaattatgcacaaacatactttaggtaaaataaacttgtcttttatgccttgc |
7290357 |
T |
|
| Q |
102 |
atggtagtgccttcaaggtccaagttatggttgatgtaaggttacattacagtgctattttgatttatagggagtgacaaaccaaaaagttcattatata |
201 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7290358 |
atggtggtgccttcaaggtccaagttatggttgatttaaggttacattacattattattttgatttatagggagtgacaaaccaaaaagttcattatata |
7290457 |
T |
|
| Q |
202 |
tagacataacaaatcacaatagaaaaatacggccctttg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7290458 |
tagacataacaaatcacaatagaaaaatatggccctttg |
7290496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University