View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3097_low_85 (Length: 244)
Name: NF3097_low_85
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3097_low_85 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 49179773 - 49179559
Alignment:
| Q |
18 |
aatcctatgtccttcaactaactgaaagcttacatttgcgagaaatccttggaaacgaggataactcttcttttaaaatacgccgatttggctttggatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49179773 |
aatcctatgtccttcaactaactgaaagcttacatttgcgagaaatccttggaaacgaggataactcttcttttaaaatacgccgatttggctttggatt |
49179674 |
T |
 |
| Q |
118 |
tgatgaatggctaatgttgattttcatgacccctaaaagccgcgcattcagtagaatatattttgtaaatcgaagttcatcttcccggccttcatagttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49179673 |
tgatgaatggctaatgttgattttcatgacccctaaaagccgcgcattcagtagaatatattttgtaaatcgaagttcatcttcccggccttcatagttt |
49179574 |
T |
 |
| Q |
218 |
atagtacatgatctg |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
49179573 |
atagtacatgatctg |
49179559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 142 - 229
Target Start/End: Original strand, 49170477 - 49170564
Alignment:
| Q |
142 |
catgacccctaaaagccgcgcattcagtagaatatattttgtaaatcgaagttcatcttcccggccttcatagtttatagtacatgat |
229 |
Q |
| |
|
||||||||||||||||||||||||| | | ||||||||||| |||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49170477 |
catgacccctaaaagccgcgcattctgcaaaatatattttgcaaattgaagttcatcttccaagccttcatagtttatagtacatgat |
49170564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 81
Target Start/End: Original strand, 49170356 - 49170419
Alignment:
| Q |
18 |
aatcctatgtccttcaactaactgaaagcttacatttgcgagaaatccttggaaacgaggataa |
81 |
Q |
| |
|
|||||||||||||||||| || |||||| ||||||| | ||||||||||||| ||||| |||| |
|
|
| T |
49170356 |
aatcctatgtccttcaaccaattgaaagtttacattcggaagaaatccttggacacgagtataa |
49170419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University