View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3097_low_95 (Length: 238)

Name: NF3097_low_95
Description: NF3097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3097_low_95
NF3097_low_95
[»] chr3 (1 HSPs)
chr3 (18-238)||(53660665-53660885)


Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 53660885 - 53660665
Alignment:
18 gagaatttgagaggaattcaaaacttggtacgagactacagttagatgctatgaggttatgtggaatggatgataaactaactattgagatggttatgat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53660885 gagaatttgagaggaattcaaaacttggtacgagactacagttagatgctatgaggttatgtggaatggatgataaactaactattgagatggttatgat 53660786  T
118 atagctttgaaatttaatatgcattatgttttttccagttctgccaatattttggtctgctacatatgttttggtcttcacataatagtgcttcacaaat 217  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53660785 atagctttgaaatttaatatgcattatgttttttccagttctgctaatattttggtctgctacatatgttttggtcttcacataatagtgcttcacaaat 53660686  T
218 tttagatatagacatatagtt 238  Q
    |||||||||||||||||||||    
53660685 tttagatatagacatatagtt 53660665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University