View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3101_high_15 (Length: 339)
Name: NF3101_high_15
Description: NF3101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3101_high_15 |
 |  |
|
| [»] scaffold0190 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 171 - 242
Target Start/End: Original strand, 27058985 - 27059056
Alignment:
| Q |
171 |
ttaaatgaaatatttagtggataagataaaactaatataagtagtttattgagatatttatgtaatttgttg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27058985 |
ttaaatgaaatatttagtggataagataaaactaatataagtagtttattgagatatttatgtagtttgttg |
27059056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 169 - 232
Target Start/End: Complemental strand, 42652114 - 42652053
Alignment:
| Q |
169 |
atttaaatgaaatatttagtggataagataaaactaatataagtagtttattgagatatttatg |
232 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| |||| || ||||||| |||||||||||||| |
|
|
| T |
42652114 |
atttaaat-aaatatttagtgaataagataaaa-taatgtacgtagtttgttgagatatttatg |
42652053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 170 - 229
Target Start/End: Original strand, 3751017 - 3751076
Alignment:
| Q |
170 |
tttaaatgaaatatttagtggataagataaaactaatataagtagtttattgagatattt |
229 |
Q |
| |
|
||||||| |||||||||||||||| ||||||| ||||||| |||||| ||||||||||| |
|
|
| T |
3751017 |
tttaaataaaatatttagtggatatgataaaagtaatatacatagtttgttgagatattt |
3751076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0190 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0190
Description:
Target: scaffold0190; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 12021 - 11961
Alignment:
| Q |
171 |
ttaaatgaaatatttagtggataagataaaactaatataagtagtttattgagatatttat |
231 |
Q |
| |
|
|||||| |||||||| ||||||||||| ||| ||| ||| | ||||| ||||||||||||| |
|
|
| T |
12021 |
ttaaataaaatattttgtggataagatcaaagtaaaatatgaagtttgttgagatatttat |
11961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 32241327 - 32241379
Alignment:
| Q |
181 |
tatttagtggataagataaaactaatataagtagtttattgagatatttatgt |
233 |
Q |
| |
|
||||||||||||||||| ||| ||||||| | | ||| ||||||||||||||| |
|
|
| T |
32241327 |
tatttagtggataagatcaaagtaatatatgaattttgttgagatatttatgt |
32241379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University