View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3101_low_17 (Length: 353)
Name: NF3101_low_17
Description: NF3101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3101_low_17 |
 | |
|
| [»] scaffold0217 (1 HSPs) |
| | |
|
| [»] scaffold0576 (1 HSPs) |
| | |
|
| [»] scaffold0199 (1 HSPs) |
| | |
|
| [»] scaffold0102 (1 HSPs) |
| | |
|
| [»] scaffold0070 (1 HSPs) |
| | |
|
| [»] scaffold0020 (1 HSPs) |
| | |
|
| [»] scaffold0019 (1 HSPs) |
| | |
|
| [»] scaffold0328 (1 HSPs) |
| | |
|
| [»] scaffold0049 (1 HSPs) |
| | |
|
| [»] scaffold0051 (1 HSPs) |
| | |
|
| [»] scaffold0623 (1 HSPs) |
| | |
|
| [»] scaffold0366 (1 HSPs) |
| | |
|
| [»] scaffold0026 (1 HSPs) |
| | |
|
| [»] scaffold0459 (1 HSPs) |
| | |
|
| [»] scaffold0016 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 5e-90; HSPs: 34)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 163 - 342
Target Start/End: Original strand, 45133055 - 45133234
Alignment:
| Q |
163 |
gcacaacacaccaccatcctccacaacacaaccgtcctccaccaccatcttcttcaccggcgctccctccattctcaaccaccatcgtcctcacccacca |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45133055 |
gcacaacacaccaccatcctccacaacacaaccgtcctccaccaccatcttcttcaccggcgctccctccattctcaaccaccatcgtcctcacccacca |
45133154 |
T |
|
| Q |
263 |
tcaatccgttcaaagctttcctctctcatgccgccgtcagaaacatccgcttctccctcaagttgcgagaaacccgttca |
342 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45133155 |
tcaattcgttcaaagctttcctctctcacgccgccgtcagaaacatccgcttctccctcaagttgtgagaaacccgttca |
45133234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 186 - 274
Target Start/End: Complemental strand, 44219205 - 44219117
Alignment:
| Q |
186 |
caacacaaccgtcctccaccaccatcttcttcaccggcgctccctccattctcaaccaccatcgtcctcacccaccatcaatccgttca |
274 |
Q |
| |
|
|||||| |||||| ||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
44219205 |
caacaccaccgtcttccaccaccgtcttcttcaccagcgctccctccattgtcaaccaccatcgtcctcacccgccatcaatctgttca |
44219117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 4852666 - 4852733
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||| || |||||||| |||| |
|
|
| T |
4852666 |
aagtggacggtggaattggtcccctcggattaatcgattcttggatcggatgccaagttttaaaaaaa |
4852733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 30466890 - 30466823
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| | ||||||||||||| ||||||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
30466890 |
aagtgggcagtgggattggtcccttcggattagtcgattcttggatcggataccgagttttaaaaaaa |
30466823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 11941270 - 11941208
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaa |
80 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
11941270 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttaa |
11941208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 36242372 - 36242319
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36242372 |
aagtgggcggtgggattggtcccctcggattaatcgattcttggatcggatacc |
36242319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 25 - 78
Target Start/End: Complemental strand, 43374383 - 43374330
Alignment:
| Q |
25 |
cggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
43374383 |
cggtgggattggtcccttcggattagtcgattcttggatcggataccgagtttt |
43374330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 34516474 - 34516414
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
34516474 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccaagtttt |
34516414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 41314128 - 41314188
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
41314128 |
aagtggacggtgggattggtcccctcagattaatcgattcttcgatcggataccaagtttt |
41314188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 86
Target Start/End: Complemental strand, 44929906 - 44929838
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaat |
86 |
Q |
| |
|
|||||||||||||||||||||| | | |||| ||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
44929906 |
aagtggacggtgggattggtccccttgaattagtcgattcttggatcggataccgagttttaaaaaaat |
44929838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 44946113 - 44946053
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
44946113 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
44946053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 25293296 - 25293363
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| || |||||||||||| |||||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
25293296 |
aagtgggcgatgggattggtcccctcggattagtcgattcttggatcggataccgagttttaaaaaaa |
25293363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 45132436 - 45132491
Alignment:
| Q |
30 |
ggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
45132436 |
ggattggtcctctcggattaatcgattcttggatcggatacctgattttaaaaaaa |
45132491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 75 - 116
Target Start/End: Original strand, 45132967 - 45133008
Alignment:
| Q |
75 |
ttttaataaaatgtaagggcaatgttggtttttcagcagaaa |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45132967 |
ttttaataaaatgtaagggcagtgttggtttttcagcagaaa |
45133008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 2140546 - 2140486
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||| |||||||||||||| |||||| |
|
|
| T |
2140546 |
aagtgggcggtgggattggtcccctcggattagtcgattattggatcggataccgagtttt |
2140486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 15038096 - 15038156
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| || ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
15038096 |
aagtgggcggtgggattggtcccctcagattagtcgattcttggatcggataccgagtttt |
15038156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 18692097 - 18692157
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||| ||||||||||||||||||||| |||||| |
|
|
| T |
18692097 |
aagtgggcggtgggattggtcccctcgtattagtcgattcttggatcggataccgagtttt |
18692157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 19054163 - 19054223
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
19054163 |
aagtgggcggtgggattggtccgctcggattagtcgattcttggatcagataccgagtttt |
19054223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 28669010 - 28669070
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||| |||||||||||||| |||||| |
|
|
| T |
28669010 |
aagtgggcggtgggattggtcccctcggattagtcgatttttggatcggataccgagtttt |
28669070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 33827633 - 33827573
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| | |||||| ||||||||||||||||||||| |||||| |
|
|
| T |
33827633 |
aagtgggcggtgggattggtccccttggattagtcgattcttggatcggataccgagtttt |
33827573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 35171937 - 35171997
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||||||| |||||||||| |||||| |
|
|
| T |
35171937 |
aagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggataccgagtttt |
35171997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 27 - 78
Target Start/End: Complemental strand, 4567480 - 4567429
Alignment:
| Q |
27 |
gtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||| |||||||| || |||||||||||||||||| |||||| |
|
|
| T |
4567480 |
gtgggattggtcctctcggattagtcaattcttggatcggatacccagtttt |
4567429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 18976515 - 18976462
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||| ||||||||||||||||||||| |
|
|
| T |
18976515 |
aagtgggcggtgggattggtcccctcgaattagtcgattcttggatcggatacc |
18976462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 14486962 - 14487022
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||| | ||||||||||||||| |||||| |
|
|
| T |
14486962 |
aagtgggcggtgggattggtcccctcggattagtcggtccttggatcggataccgagtttt |
14487022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 27269404 - 27269344
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||| ||| |||||||| ||||||||||||| ||||||| |||||| |
|
|
| T |
27269404 |
aagtgggcggtgggattgatcccctcggattagtcgattcttggataggataccgagtttt |
27269344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 31778168 - 31778228
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||| |||||||||| || ||||| || ||||||||||||||||| |||||| |
|
|
| T |
31778168 |
aagtggacggtgagattggtcctctcagattagtcagttcttggatcggataccgagtttt |
31778228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 5394154 - 5394207
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||| ||| | ||| ||||||||||| |
|
|
| T |
5394154 |
aagtgggcggtgggattggtccgttcggattagtcggtccttagatcggatacc |
5394207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 25 - 70
Target Start/End: Original strand, 8259041 - 8259086
Alignment:
| Q |
25 |
cggtgggattggtcctttcggattaatcgattcttggatcggatac |
70 |
Q |
| |
|
|||||||||| || | ||||||||| |||||||||||||||||||| |
|
|
| T |
8259041 |
cggtgggattagttccttcggattagtcgattcttggatcggatac |
8259086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 6714355 - 6714295
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||| ||||||||| || |||| ||||||||||||| ||||||| |||||| |
|
|
| T |
6714355 |
aagtggacggtgagattggtcccctcaaattagtcgattcttggattggataccgagtttt |
6714295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 8192412 - 8192352
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| |||||||||||| || |||||||| ||| | ||||||||||||||| |||||| |
|
|
| T |
8192412 |
aagtgggcggtgggattgggcccctcggattagtcggtccttggatcggataccgagtttt |
8192352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 24196139 - 24196199
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||| || ||| ||||||| |||||| |
|
|
| T |
24196139 |
aagtgggcggtgggattggtcccctcggattagtcgattttttgattggataccgagtttt |
24196199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 42 - 78
Target Start/End: Original strand, 27290735 - 27290771
Alignment:
| Q |
42 |
tcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
27290735 |
tcggattagtcgattcttggatcggataccgagtttt |
27290771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 39957895 - 39957955
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| || |||||||||| | |||||||| ||||||||||||| ||||||| |||||| |
|
|
| T |
39957895 |
aagtgggcgatgggattggttccctcggattagtcgattcttggattggataccgagtttt |
39957955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 44610176 - 44610236
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||| |||||||| || ||||| |||||| |
|
|
| T |
44610176 |
aagtgggcggtgggattggtcccatcggattagtcggttcttggaccgaataccgagtttt |
44610236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 94; Significance: 8e-46; HSPs: 30)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 173 - 342
Target Start/End: Original strand, 42226220 - 42226389
Alignment:
| Q |
173 |
ccaccatcctccacaacacaaccgtcctccaccaccatcttcttcaccggcgctccctccattctcaaccaccatcgtcctcacccaccatcaatccgtt |
272 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42226220 |
ccaccatcttccacaacaccgtcgtcctccaccacaatcttcttcaccggcgctccctccattctcaaccaccatcgtcctcacccaccatcaatccgtt |
42226319 |
T |
|
| Q |
273 |
caaagctttcctctctcatgccgccgtcagaaacatccgcttctccctcaagttgcgagaaacccgttca |
342 |
Q |
| |
|
||||| | ||||||||| ||| | ||| | || | | ||||||||||| |||| |||||||||||||| |
|
|
| T |
42226320 |
caaagttggcctctctcacgccactgtctgcgacgtactcttctccctcacgttgtgagaaacccgttca |
42226389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 24122160 - 24122222
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaa |
80 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
24122160 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttaa |
24122222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 78
Target Start/End: Complemental strand, 27454922 - 27454864
Alignment:
| Q |
20 |
gtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||| ||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27454922 |
gtgggcggtgggattggtcccctcggattagtcgattcttggatcggatacctagtttt |
27454864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 4621297 - 4621237
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
4621297 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
4621237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 34778476 - 34778535
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttt |
77 |
Q |
| |
|
|||||||||||||||||||||| | |||||| ||||||||||||||||||||| ||||| |
|
|
| T |
34778476 |
aagtggacggtgggattggtccccttggattagtcgattcttggatcggataccgagttt |
34778535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 23041659 - 23041721
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaa |
80 |
Q |
| |
|
|||||||| ||||||||||||| ||| |||| ||||||||||||||||||||| |||||||| |
|
|
| T |
23041659 |
aagtggacagtgggattggtcccctcgaattagtcgattcttggatcggataccgagttttaa |
23041721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 36155946 - 36155881
Alignment:
| Q |
20 |
gtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||| ||||||||||||||| ||| |||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
36155946 |
gtgggcggtgggattggtcccttcaaattagtcgattcttggatcggataccgagttttaaaaaaa |
36155881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 48699896 - 48699956
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||| ||| ||||||||| ||||||||||||||||||| | |||||| |
|
|
| T |
48699896 |
aagtgggcggtgggattgttcccttcggattagtcgattcttggatcggatatcgagtttt |
48699956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 17935906 - 17935965
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttt |
77 |
Q |
| |
|
|||||| || |||||||||||| |||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
17935906 |
aagtgggcgatgggattggtccactcggattagtcgattcttggatcggataccgagttt |
17935965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 24674530 - 24674597
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||| ||||||||||||||||||||| | |||||| |||| |
|
|
| T |
24674530 |
aagtgggcggtgggattggtcccctcgtattagtcgattcttggatcggataccgaattttaaaaaaa |
24674597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 26513208 - 26513141
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| |||||||| |||||| |||||||| ||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
26513208 |
aagtgggcggtgggaatggtcccctcggattagtcgattcttggatcgaataccgagttttaaaaaaa |
26513141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 45331681 - 45331614
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
45331681 |
aagtggacggtgggattaatcccctcagattaatcgattcttgaatcggataccgagttttaaaaaaa |
45331614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 5315478 - 5315535
Alignment:
| Q |
28 |
tgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
5315478 |
tgggattggtcccctcggataagtcgattcttggatcggataccgagttttaaaaaaa |
5315535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 79 - 116
Target Start/End: Original strand, 42226116 - 42226153
Alignment:
| Q |
79 |
aataaaatgtaagggcaatgttggtttttcagcagaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42226116 |
aataaaatgtaagggcaatgttggtttttcaccagaaa |
42226153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 7197307 - 7197247
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||| ||||||||| |||||||| ||||||| ||||||||||||| |||||| |
|
|
| T |
7197307 |
aagtgggcggtgagattggtcccctcggattagtcgattcatggatcggataccgagtttt |
7197247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 7766787 - 7766727
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||||||| |||||||| | |||||| |
|
|
| T |
7766787 |
aagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggatatcgagtttt |
7766727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 9500415 - 9500355
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||| |||||||| ||||||||| ||||||||||||||||||| | |||||| |
|
|
| T |
9500415 |
aagtgggcggtgagattggtctcttcggattagtcgattcttggatcggatatcgagtttt |
9500355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 15059462 - 15059402
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||| ||||||||| ||| |||| ||||||||||||||||||||| |||||| |
|
|
| T |
15059462 |
aagtgggcggtgagattggtcccctcgaattagtcgattcttggatcggataccgagtttt |
15059402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 37351513 - 37351454
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttt |
77 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||| | ||||||||||||||| ||||| |
|
|
| T |
37351513 |
aagtgggcggtgggattggtcccctcggattagtcggtccttggatcggataccgagttt |
37351454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 32 - 78
Target Start/End: Original strand, 14603947 - 14603993
Alignment:
| Q |
32 |
attggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
14603947 |
attggtcccctcggattagtcgattcttggatcggataccgagtttt |
14603993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 1379034 - 1379087
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
|||||||||||| ||||||||| || ||||| ||||||||| ||||||||||| |
|
|
| T |
1379034 |
aagtggacggtgagattggtcccctcagattagtcgattcttagatcggatacc |
1379087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 25 - 70
Target Start/End: Complemental strand, 8779789 - 8779744
Alignment:
| Q |
25 |
cggtgggattggtcctttcggattaatcgattcttggatcggatac |
70 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||||||||| |
|
|
| T |
8779789 |
cggtgggattggtcccctcggattagtcgattcttagatcggatac |
8779744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 21726866 - 21726919
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
|||||| ||||||| ||| ||| || ||||||||||||||||||||||||||| |
|
|
| T |
21726866 |
aagtgggcggtggggttgatcccctcagattaatcgattcttggatcggatacc |
21726919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 1486557 - 1486617
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||||| ||||| || ||||| ||| | ||||||||||||||| |||||| |
|
|
| T |
1486557 |
aagtggacggtgggatcggtcccctccgattagtcggtccttggatcggataccgagtttt |
1486617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 18533784 - 18533724
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| | ||||||||||||| || |||||||||||||| ||||||||||| |||||| |
|
|
| T |
18533784 |
aagtgggccgtgggattggtcccctcatattaatcgattcttagatcggataccaagtttt |
18533724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 22910008 - 22910068
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| |||||||||| |||| |||||||| ||||| ||| ||||||||||| |||||| |
|
|
| T |
22910008 |
aagtgggcggtgggatttgtcccctcggattagtcgatacttcgatcggataccgagtttt |
22910068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 27159222 - 27159282
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||||||||||| || ||||| ||||| |||||||||||| | |||||| |
|
|
| T |
27159222 |
aagtggacggtgggattggtcccctcagattagtcgatctttggatcggatatcgagtttt |
27159282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 33905570 - 33905510
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||||||| ||| || ||| |||||||||| ||||||||||| |||||| |
|
|
| T |
33905570 |
aagtggacggtgggattgatcccctcaaatttatcgattctttgatcggataccgagtttt |
33905510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 50202683 - 50202742
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| |||||| |||||||| |||||||||||||||||| ||||||||| | |||||| |
|
|
| T |
50202683 |
aagtgggcggtggaattggtcccctcggattaatcgattctt-gatcggatatcgagtttt |
50202742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 52135263 - 52135315
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatac |
70 |
Q |
| |
|
|||||||||||||||||||||| || |||| ||| |||||||||||||||| |
|
|
| T |
52135263 |
aagtggacggtgggattggtcccctcatattagtcggttcttggatcggatac |
52135315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 52; Significance: 9e-21; HSPs: 20)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 9690698 - 9690631
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
9690698 |
aagtggacggtgggattggtcctctcggattagtcgattcttggatcggataccgagttttaaaaaaa |
9690631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 1345072 - 1345132
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||||||||||| | |||||| ||||||||||||||||||||| |||||| |
|
|
| T |
1345072 |
aagtggacggtgggattggtccccttggattagtcgattcttggatcggataccgagtttt |
1345132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 3222696 - 3222636
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
3222696 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
3222636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 86
Target Start/End: Original strand, 9844075 - 9844143
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaat |
86 |
Q |
| |
|
|||||| ||||| ||||||||| ||||||||| ||||||||||||||||||| | |||||| ||||||| |
|
|
| T |
9844075 |
aagtgggcggtgagattggtcccttcggattagtcgattcttggatcggatatcgagttttcataaaat |
9844143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 34147483 - 34147543
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
34147483 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
34147543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 34160099 - 34160159
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
34160099 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
34160159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 9239112 - 9239171
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttt |
77 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
9239112 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
9239171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 25 - 78
Target Start/End: Complemental strand, 15360151 - 15360098
Alignment:
| Q |
25 |
cggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
15360151 |
cggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
15360098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 654206 - 654146
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||| |||||||||||||| |||||| |
|
|
| T |
654206 |
aagtgggcggtgggattggtcccctcggattagtcgattattggatcggataccgagtttt |
654146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 11007302 - 11007362
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| |||||||||||| || |||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
11007302 |
aagtgggcggtgggattggccccctcggattagtcgattctttgatcggatacctagtttt |
11007362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 26 - 78
Target Start/End: Original strand, 14213027 - 14213079
Alignment:
| Q |
26 |
ggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
14213027 |
ggtgggattggtccactcggattagtcgattcttggatcggataccgagtttt |
14213079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 21148571 - 21148511
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||||||| |||||||||| |||||| |
|
|
| T |
21148571 |
aagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggataccgagtttt |
21148511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 21982380 - 21982321
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| | ||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
21982380 |
aagtgggcggtgggattggtccct-cggattagtcgattcttggatcggataccgagtttt |
21982321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 28672204 - 28672264
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
28672204 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcagataccgagtttt |
28672264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 33718529 - 33718478
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggata |
69 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| ||||||||||||||||||| |
|
|
| T |
33718529 |
aagtggacggtgggattgatcccctcggattagtcgattcttggatcggata |
33718478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 5360131 - 5360071
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||| ||||||||| ||||||||||| |||||| |
|
|
| T |
5360131 |
aagtgggcggtgggattggtcccctcgaattagtcgattcttagatcggataccgagtttt |
5360071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 11449008 - 11449068
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||||||| |||||||| | |||||| |
|
|
| T |
11449008 |
aagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggatatcgagtttt |
11449068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 11841037 - 11841097
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||||||| |||| ||| |||| |||||| |||||||||||||| |||||| |
|
|
| T |
11841037 |
aagtggacggtgggattagtcccctcgaattagtcgattattggatcggataccgagtttt |
11841097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 15730553 - 15730488
Alignment:
| Q |
20 |
gtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||| |||||||||||||| |||||||| ||||||||| ||||||||| | |||||||| |||| |
|
|
| T |
15730553 |
gtgggcggtgggattggtcacctcggattagtcgattctttgatcggatatcgagttttaaaaaaa |
15730488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 14504142 - 14504082
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||| |||| ||| |||| ||||| |||| |||||||||| |||||| |
|
|
| T |
14504142 |
aagtgggcggtgggattgatcctctcgaattagtcgatccttgtatcggataccgagtttt |
14504082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 37)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 34310279 - 34310346
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
34310279 |
aagtggacggtgggattggtcccctcgaattaatcgattcttggatcggataccgagttttaaaaaaa |
34310346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 38631039 - 38630979
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38631039 |
aagtgggcggtgggattggtcccctcggattaatcgattcttggatcggataccgagtttt |
38630979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 9659371 - 9659304
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | ||||||||||| ||||||| |||||||| |||| |
|
|
| T |
9659371 |
aagtggacggtgggattggtcccttcggattagttgattcttggatgggataccgagttttaaaaaaa |
9659304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 22693072 - 22693139
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
22693072 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttaaaaaaa |
22693139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 35425150 - 35425203
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
|||||| |||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
35425150 |
aagtgggcggtgggattggtcctctcggattagtcgattcttggatcggatacc |
35425203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 8484721 - 8484661
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
8484721 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
8484661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 18207344 - 18207404
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
18207344 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
18207404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 19456271 - 19456211
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
19456271 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
19456211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 27498791 - 27498731
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
27498791 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
27498731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 37495191 - 37495251
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
37495191 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
37495251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 41351164 - 41351104
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
41351164 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
41351104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 11926553 - 11926494
Alignment:
| Q |
26 |
ggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
11926553 |
ggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttaaaaaaa |
11926494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 13659305 - 13659243
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaa |
80 |
Q |
| |
|
|||||| ||||||||||| ||| |||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
13659305 |
aagtgggcggtgggattgatcccctcggattaatcgattcttggatcggataccgaattttaa |
13659243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 27487614 - 27487552
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaa |
80 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
27487614 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggatacagagttttaa |
27487552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 33709563 - 33709510
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
33709563 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggatacc |
33709510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 4603914 - 4603974
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||| | ||||||||||||||| |||||| |
|
|
| T |
4603914 |
aagtggacggtgggattggtcccctcggattagtcggtccttggatcggataccgagtttt |
4603974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 7085686 - 7085626
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||||||| |||||||||| |||||| |
|
|
| T |
7085686 |
aagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggataccgagtttt |
7085626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 10869625 - 10869565
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
10869625 |
aagtgggcggtgggattggtcccctcggattagtcggttcttggatcggataccaagtttt |
10869565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 21 - 85
Target Start/End: Complemental strand, 23270579 - 23270515
Alignment:
| Q |
21 |
tggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
||||||||||||||||||| |||||||| | ||||||||||| ||||||| |||||||| |||| |
|
|
| T |
23270579 |
tggacggtgggattggtcccctcggattagttgattcttggattggataccaagttttaaaaaaa |
23270515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 30485965 - 30486025
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| || |||||||||||||||||| |||||| |
|
|
| T |
30485965 |
aagtgggcggtgggattggtcccctcggattagtcaattcttggatcggataccgagtttt |
30486025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 27 - 78
Target Start/End: Complemental strand, 10631340 - 10631289
Alignment:
| Q |
27 |
gtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
10631340 |
gtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
10631289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 25750665 - 25750606
Alignment:
| Q |
26 |
ggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||| ||||||||| ||| ||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
25750665 |
ggtgagattggtcccttcagattagtcgattcttggatcggataccgagttttaaaaaaa |
25750606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 19145472 - 19145410
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaa |
80 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| | | ||||||||||||||||| |||||||| |
|
|
| T |
19145472 |
aagtgggcggtgggattggtcccctcggattagttggttcttggatcggataccgagttttaa |
19145410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 25 - 71
Target Start/End: Original strand, 38684351 - 38684397
Alignment:
| Q |
25 |
cggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
38684351 |
cggtgggattggtcccctcggattagtcgattcttggatcggatacc |
38684397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 21 - 78
Target Start/End: Original strand, 5049276 - 5049333
Alignment:
| Q |
21 |
tggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||||||||| ||| |||| ||||||||||||||| ||||| |||||| |
|
|
| T |
5049276 |
tggacggtgggattggtcccatcgaattagtcgattcttggatcgaataccaagtttt |
5049333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 15641165 - 15641106
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||| ||||||||||| |||||| |
|
|
| T |
15641165 |
aagtgggcggtgggattggtcccctcggattagtcgattctt-gatcggataccgagtttt |
15641106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 32059500 - 32059440
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||| | ||||||||||||||| |||||| |
|
|
| T |
32059500 |
aagtgggcggtgggattggtcccctcggattagtcggtccttggatcggataccgagtttt |
32059440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 69
Target Start/End: Original strand, 42193620 - 42193671
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggata |
69 |
Q |
| |
|
|||||| ||||||| |||||||| |||||||| |||||||||||||| |||| |
|
|
| T |
42193620 |
aagtgggcggtggggttggtcctctcggattagtcgattcttggatcagata |
42193671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 5067398 - 5067447
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcgga |
67 |
Q |
| |
|
|||||| ||||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
5067398 |
aagtgggcggtgggattggtcccctctgattagtcgattcttggatcgga |
5067447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 71
Target Start/End: Complemental strand, 11464960 - 11464915
Alignment:
| Q |
26 |
ggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
|||||||||||||| ||| |||| ||||||||||||||||||||| |
|
|
| T |
11464960 |
ggtgggattggtcccctcgaattagtcgattcttggatcggatacc |
11464915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 25 - 78
Target Start/End: Complemental strand, 25548587 - 25548534
Alignment:
| Q |
25 |
cggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||| | ||| |||| ||||||||||||||| ||||| |||||| |
|
|
| T |
25548587 |
cggtgggattggtcatctcgaattagtcgattcttggatcgaataccgagtttt |
25548534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 78
Target Start/End: Complemental strand, 28614543 - 28614486
Alignment:
| Q |
21 |
tggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||||| ||| ||| |||| |||||| |||||||||||||| |||||| |
|
|
| T |
28614543 |
tggacggtgggattgatcccctcgaattagtcgatttttggatcggataccgagtttt |
28614486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 86
Target Start/End: Complemental strand, 930546 - 930478
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaat |
86 |
Q |
| |
|
|||||||| ||| ||||||||| |||||||| ||| | ||||||||||||| | |||||||| ||||| |
|
|
| T |
930546 |
aagtggacagtgtgattggtcccctcggattagtcggtccttggatcggatatcgagttttaaaaaaat |
930478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 13038515 - 13038463
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatac |
70 |
Q |
| |
|
|||||| ||||||||||| ||| ||| |||| |||||||||||||||||||| |
|
|
| T |
13038515 |
aagtgggcggtgggattgatcccctcgaattagtcgattcttggatcggatac |
13038463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 13108510 - 13108458
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatac |
70 |
Q |
| |
|
|||||| ||||||||||| ||| ||| |||| |||||||||||||||||||| |
|
|
| T |
13108510 |
aagtgggcggtgggattgatcccctcgaattagtcgattcttggatcggatac |
13108458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 22392825 - 22392885
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| |||||| |||||||| || ||||| |||||| |||||||||||||| |||||| |
|
|
| T |
22392825 |
aagtgggcggtggaattggtcccctcagattagtcgatttttggatcggataccgagtttt |
22392885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 38086413 - 38086361
Alignment:
| Q |
19 |
agtggacggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
||||||||||||||||||||| ||| |||| ||| |||||||||| |||||| |
|
|
| T |
38086413 |
agtggacggtgggattggtcccttcaaattagtcggttcttggatcagatacc |
38086361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 39)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 23639761 - 23639821
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
23639761 |
aagtggacggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
23639821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 23645419 - 23645479
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
23645419 |
aagtggacggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
23645479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 51595159 - 51595221
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaa |
80 |
Q |
| |
|
||||||||||||| |||| || ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51595159 |
aagtggacggtggaattgatctcttcggattaatcgattcttggatcggataccgagttttaa |
51595221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 5609262 - 5609202
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
5609262 |
aagtggacggtgggattgatcccctcggattagtcgattcttggatcggataccgagtttt |
5609202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 26 - 78
Target Start/End: Original strand, 34723944 - 34723996
Alignment:
| Q |
26 |
ggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
34723944 |
ggtgggattggtcctctcggattagtcgattcttggatcggataccgagtttt |
34723996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 34844818 - 34844758
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
34844818 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
34844758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 40058912 - 40058852
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
40058912 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
40058852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 45787764 - 45787704
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| ||||||||||||||||||||| |||||| |
|
|
| T |
45787764 |
aagtggacggtgggattggtcccctcgaattagtcgattcttggatcggataccgagtttt |
45787704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 52983756 - 52983815
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttt |
77 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
52983756 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
52983815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 17 - 71
Target Start/End: Complemental strand, 43719148 - 43719094
Alignment:
| Q |
17 |
aaagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
||||||| |||||||||||||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
43719148 |
aaagtgggcggtgggattggtcatctcggattagtcgattcttggatcggatacc |
43719094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 52494625 - 52494687
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaa |
80 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||| ||||||||||||||||||||| |||||||| |
|
|
| T |
52494625 |
aagtgggcggtgggattggtcccctcgaattagtcgattcttggatcggataccgagttttaa |
52494687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 19660592 - 19660532
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
19660592 |
aagtgggcggtgggattgatcccctcggattagtcgattcttggatcggataccgagtttt |
19660532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 27528855 - 27528795
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||| ||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
27528855 |
aagtgggcggtgagattggtcccctcggattagtcgattcttggatcggataccgagtttt |
27528795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 32986334 - 32986394
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| ||||| || ||||||||||||||||||||| |||||| |
|
|
| T |
32986334 |
aagtgggcggtgggattggtcccctcggaatagtcgattcttggatcggataccgagtttt |
32986394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 86
Target Start/End: Complemental strand, 33696339 - 33696271
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaat |
86 |
Q |
| |
|
|||||| ||||| |||||||||| |||||||| || |||||||||||||||| | |||||||| ||||| |
|
|
| T |
33696339 |
aagtgggcggtgagattggtcctctcggattagtcaattcttggatcggatatcgagttttaaaaaaat |
33696271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 12824537 - 12824604
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
||||||||||||||||||||| ||| |||| |||||||||||||||||||| |||||||| |||| |
|
|
| T |
12824537 |
aagtggacggtgggattggtctcatcgaattagtcgattcttggatcggatacggagttttaaaaaaa |
12824604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 33289191 - 33289258
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||||||||| |||| |||| |||||||| ||||||||||||||||||||| ||||||| |||| |
|
|
| T |
33289191 |
aagtggacggtgagattagtcccctcggattagtcgattcttggatcggataccgggttttaaaaaaa |
33289258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 30879226 - 30879173
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
|||||||||||||||||||| | || |||||||||||||||||||| |||||| |
|
|
| T |
30879226 |
aagtggacggtgggattggttccctcagattaatcgattcttggatcagatacc |
30879173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 63
Target Start/End: Original strand, 32942507 - 32942552
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggat |
63 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
32942507 |
aagtggacggtgggattggtcccctcggataaatcgattcttggat |
32942552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 37302624 - 37302677
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
|||||| || |||||||||||| ||||||||| |||||||||| |||||||||| |
|
|
| T |
37302624 |
aagtgggcgatgggattggtcccttcggattagtcgattcttgaatcggatacc |
37302677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 55961814 - 55961761
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||||||||||||| |||| ||||| |
|
|
| T |
55961814 |
aagtgggcggtgggattggttccttcggattaatcgattcttgaatcgaatacc |
55961761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 9978569 - 9978509
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| | ||||||| ||||||||||| |||||| |
|
|
| T |
9978569 |
aagtgggcggtgggattggtcccatcggattagttgattcttagatcggataccgagtttt |
9978509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 27 - 71
Target Start/End: Original strand, 13871325 - 13871369
Alignment:
| Q |
27 |
gtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||| ||||||||||| |
|
|
| T |
13871325 |
gtgggattggtccttttggattagtcgattcttagatcggatacc |
13871369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 35229312 - 35229372
Alignment:
| Q |
25 |
cggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
||||||||||||||| ||| |||| ||||||||||||||||||||| | |||||| |||| |
|
|
| T |
35229312 |
cggtgggattggtcccctcgaattagtcgattcttggatcggataccgaattttaaaaaaa |
35229372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 44343651 - 44343711
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||| |||||||||| |||||||||| |||||| |
|
|
| T |
44343651 |
aagtgggcggtgggattggtcccctcgaattagtcgattcttgaatcggataccgagtttt |
44343711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 46714530 - 46714590
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| || ||||||| |||||||||| |||||| |
|
|
| T |
46714530 |
aagtgggcggtgggattggtcccctcggattagtcaattcttgaatcggataccgagtttt |
46714590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 69
Target Start/End: Original strand, 4064997 - 4065048
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggata |
69 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||| |||||||||||| |
|
|
| T |
4064997 |
aagtgggcggtgggattggtcccctcggattagtcgatttttggatcggata |
4065048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 7093508 - 7093575
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||||||| |||| |||| ||| | ||||||||||||| | |||||||| |||| |
|
|
| T |
7093508 |
aagtgggcggtgggattggtcccttcgaattagtcggtccttggatcggatatcgagttttaaaaaaa |
7093575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 20566487 - 20566554
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| || |||||||||||| || ||||| ||||||||||||||||||| | |||||||| |||| |
|
|
| T |
20566487 |
aagtgggcgctgggattggtcccctcagattagtcgattcttggatcggatatcgagttttaaaaaaa |
20566554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 76
Target Start/End: Complemental strand, 20078044 - 20077986
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtt |
76 |
Q |
| |
|
|||||| |||||||||| || | |||||||| ||||||||||||||||||||| |||| |
|
|
| T |
20078044 |
aagtgggcggtgggattagttccctcggattagtcgattcttggatcggataccgagtt |
20077986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 25 - 71
Target Start/End: Original strand, 37172909 - 37172955
Alignment:
| Q |
25 |
cggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
||||| ||||| ||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
37172909 |
cggtgagattgatcctttcggattagtcgatccttggatcggatacc |
37172955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 25852362 - 25852419
Alignment:
| Q |
28 |
tgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||| |||||||| |||||||| |||| |
|
|
| T |
25852362 |
tgggattggtcccctcggattagtcggttcttggaccggataccgagttttaaaaaaa |
25852419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 51535758 - 51535811
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||| ||||||||| ||||||||||| |
|
|
| T |
51535758 |
aagtgggcggtgggattggtcccctcgaattagtcgattcttagatcggatacc |
51535811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 23131496 - 23131436
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| |||| |||||||||| ||| |||| ||||||||| ||||||||||| |||||| |
|
|
| T |
23131496 |
aagtgggcggtaggattggtcccctcgaattagtcgattcttcgatcggataccgagtttt |
23131436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 27574455 - 27574507
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatac |
70 |
Q |
| |
|
|||||| ||||| | ||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
27574455 |
aagtgggcggtgagtttggtcccctcggattaatcaattcttggatcggatac |
27574507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 32990572 - 32990624
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatac |
70 |
Q |
| |
|
|||||| ||||||||||||||| ||||| || ||||||||||||||| |||| |
|
|
| T |
32990572 |
aagtgggcggtgggattggtcccctcggactagtcgattcttggatcgaatac |
32990624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 36131570 - 36131510
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||| || |||| |||||| |||||| |
|
|
| T |
36131570 |
aagtgggcggtgggattggtcccctcggattagtcgattattagatcagataccgagtttt |
36131510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 54127402 - 54127350
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatac |
70 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||| |||||||| ||||||| |
|
|
| T |
54127402 |
aagtgggcggtgggattggtcccctcggattagtcggttcttggaccggatac |
54127350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 78
Target Start/End: Complemental strand, 55158395 - 55158343
Alignment:
| Q |
26 |
ggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||| |||||||| |||||| |||||||||| ||| |||||| |
|
|
| T |
55158395 |
ggtgggattggtcccctcggattagtcgatttttggatcggaaaccgagtttt |
55158343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 45)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 10083879 - 10083819
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
10083879 |
aagtggacggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
10083819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 10190802 - 10190742
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
10190802 |
aagtggacggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
10190742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 4048087 - 4048154
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||||||||||||||||||| |||||||| | ||||||||||||||||||| |||||||| |||| |
|
|
| T |
4048087 |
aagtggacggtgggattggtcccctcggattagttgattcttggatcggataccgagttttaaaaaaa |
4048154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 21363080 - 21363147
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
21363080 |
aagtgggcggtgggattggttccctcggattaatcgattcttggatcggataccgagttttaaaaaaa |
21363147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 24407398 - 24407465
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
24407398 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttaaaaaaa |
24407465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 49258322 - 49258255
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
49258322 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttaaaaaaa |
49258255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 52821696 - 52821634
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaa |
80 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
52821696 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttaa |
52821634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 8097339 - 8097279
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
8097339 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
8097279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 26174250 - 26174310
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
26174250 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
26174310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 86
Target Start/End: Original strand, 48105014 - 48105082
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaat |
86 |
Q |
| |
|
|||||| ||||| ||||||||| ||||||||| ||||||||||||||||||||| ||||| || ||||| |
|
|
| T |
48105014 |
aagtgggcggtgagattggtcccttcggattagtcgattcttggatcggataccgagtttaaaaaaaat |
48105082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 53848494 - 53848434
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
53848494 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
53848434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 18176947 - 18176880
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||||||||||||||||| |||||||| |||| |
|
|
| T |
18176947 |
aagtgggcggtgggattggtcccatcggattagtcgattcttggatcggatacagagttttaaaaaaa |
18176880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 39041904 - 39041845
Alignment:
| Q |
26 |
ggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
39041904 |
ggtgggattggtccactcggattagtcgattcttggatcggataccgagttttaaaaaaa |
39041845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 7485590 - 7485529
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaa |
80 |
Q |
| |
|
|||||| ||||||||||||||| | ||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
7485590 |
aagtggccggtgggattggtccct-cggattagtcgattcttggatcggataccgagttttaa |
7485529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 25 - 78
Target Start/End: Complemental strand, 53424230 - 53424177
Alignment:
| Q |
25 |
cggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
53424230 |
cggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
53424177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 4252456 - 4252404
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatac |
70 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||| |||||||||||||| |
|
|
| T |
4252456 |
aagtggacggtgggattggtcccctcggattagtcgatccttggatcggatac |
4252404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 8958095 - 8958035
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| || |||||||||||||||||||| |||||| |||||| |
|
|
| T |
8958095 |
aagtgggcggtgggattggtcccctctgattaatcgattcttggatcagataccgagtttt |
8958035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 15566560 - 15566500
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| || ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
15566560 |
aagtgggcggtgggattggtcccctcagattagtcgattcttggatcggataccgagtttt |
15566500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 24165775 - 24165715
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
24165775 |
aagtgggcggtgggattgttcccctcggattagtcgattcttggatcggataccgagtttt |
24165715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 40133509 - 40133449
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||| ||||||||||||||||||||| |||||| |
|
|
| T |
40133509 |
aagtgggcggtgggattggtcccctcgaattagtcgattcttggatcggataccgagtttt |
40133449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 50731297 - 50731233
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaata |
82 |
Q |
| |
|
|||||| ||||||||||||||| || ||||| ||||| ||||||||||||||| |||||||||| |
|
|
| T |
50731297 |
aagtgggcggtgggattggtcccctcagattagtcgatccttggatcggataccgagttttaata |
50731233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 82
Target Start/End: Original strand, 50781557 - 50781621
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaata |
82 |
Q |
| |
|
|||||| ||||||||||||||| || ||||| ||||| ||||||||||||||| |||||||||| |
|
|
| T |
50781557 |
aagtgggcggtgggattggtcccctcagattagtcgatccttggatcggataccgagttttaata |
50781621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 35493048 - 35493115
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||| | ||||| |||||||| |||| |
|
|
| T |
35493048 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggattgaataccgagttttaaaaaaa |
35493115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 54475818 - 54475885
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||||||| | |||||| |||||||||||||| |||||| |||||||| |||| |
|
|
| T |
54475818 |
aagtgggcggtgggattggtccccttggattagtcgattcttggatcagataccgagttttaaaaaaa |
54475885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 25 - 70
Target Start/End: Original strand, 25379905 - 25379950
Alignment:
| Q |
25 |
cggtgggattggtcctttcggattaatcgattcttggatcggatac |
70 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
25379905 |
cggtgggattggtcccctcggattagtcgattcttggatcggatac |
25379950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 30257761 - 30257814
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
|||||| |||||| |||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
30257761 |
aagtgggcggtggcattggtcccctcggattagtcgattcttggatcggatacc |
30257814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 78
Target Start/End: Original strand, 3747730 - 3747778
Alignment:
| Q |
30 |
ggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
3747730 |
ggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
3747778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 8456210 - 8456150
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| | ||||||||||||| |||||||| |||||||||| |||||||||| |||||| |
|
|
| T |
8456210 |
aagtgggcagtgggattggtcccctcggattagtcgattcttgaatcggataccgagtttt |
8456150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 25289774 - 25289715
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| | || |||| ||||||||||||||||||||| |||||| |
|
|
| T |
25289774 |
aagtgggcggtgggattggtccct-cgaattagtcgattcttggatcggataccgagtttt |
25289715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 30807212 - 30807153
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| |||| |||||||||| | ||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
30807212 |
aagtgggcggtaggattggtccct-cggattagtcgattcttggatcggataccgagtttt |
30807153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 32151561 - 32151621
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||| ||||||||| ||| |||| ||||||||||||||||||||| |||||| |
|
|
| T |
32151561 |
aagtgggcggtgagattggtcccctcgaattagtcgattcttggatcggataccgagtttt |
32151621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 34492635 - 34492575
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| ||| ||||| | |||||||||||| |||||| |||||| |
|
|
| T |
34492635 |
aagtgggcggtgggattggtccattcagattagttgattcttggatctgataccgagtttt |
34492575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 45272476 - 45272416
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| | || |||||||||||||||| |||||| |
|
|
| T |
45272476 |
aagtgggcggtgggattggtcccctcggattagttgactcttggatcggataccgagtttt |
45272416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 45529814 - 45529755
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||| ||||||||||| |||||| |
|
|
| T |
45529814 |
aagtgggcggtgggattggtcccctcggattagtcgattctt-gatcggataccgagtttt |
45529755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 46576485 - 46576545
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| |||| |||||||||| | |||||| ||||||||||||||||||||| |||||| |
|
|
| T |
46576485 |
aagtgggcggtcggattggtccccttggattagtcgattcttggatcggataccgagtttt |
46576545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 48977525 - 48977585
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||| | ||||||||||||||| |||||| |
|
|
| T |
48977525 |
aagtgggcggtgggattggtcccctcggattagtcggtccttggatcggataccgagtttt |
48977585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 78
Target Start/End: Complemental strand, 52455701 - 52455649
Alignment:
| Q |
26 |
ggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||| ||||||| |||||| |
|
|
| T |
52455701 |
ggtgggattggtcccctcggattagtcgattcttggattggataccgagtttt |
52455649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 53233970 - 53233911
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||| ||||||||||| |||||| |
|
|
| T |
53233970 |
aagtgggcggtgggattggtcccctcggattagtcgattctt-gatcggataccgagtttt |
53233911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 55371354 - 55371302
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatac |
70 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||| |||||||||||||| |
|
|
| T |
55371354 |
aagtgggcggtgggattggtcccctcggattagtcgatccttggatcggatac |
55371302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 25017626 - 25017692
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||||| | || |||||| ||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
25017626 |
aagtgggcggtgggattggttcctt-ggattagtcgattcttggatcgaataccgagttttaaaaaaa |
25017692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 33398528 - 33398461
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||||| | ||| |||| ||||||||||||||||||||| | |||||| |||| |
|
|
| T |
33398528 |
aagtgggcggtgggattggttccctcgaattagtcgattcttggatcggataccgaattttaaaaaaa |
33398461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 78
Target Start/End: Original strand, 1178310 - 1178367
Alignment:
| Q |
20 |
gtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||| ||||||||||||||| | ||||||| |||| |||||||||||||||| |||||| |
|
|
| T |
1178310 |
gtgggcggtgggattggtccct-cggattagtcgaatcttggatcggataccgagtttt |
1178367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 4462769 - 4462831
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaa |
80 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| | |||||||||| ||||||| |||||||| |
|
|
| T |
4462769 |
aagtggacggtgggattgatccactcggattagtttattcttggattggataccgagttttaa |
4462831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 78
Target Start/End: Original strand, 14997755 - 14997807
Alignment:
| Q |
26 |
ggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| ||| |||||| |||||| |
|
|
| T |
14997755 |
ggtgggattggtcccctcgaattaatcgattcttgtatcagataccgagtttt |
14997807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 78
Target Start/End: Complemental strand, 32094809 - 32094757
Alignment:
| Q |
26 |
ggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||||| || |||| ||| ||||||||||||||||| |||||| |
|
|
| T |
32094809 |
ggtgggattggtcctctcatattagtcggttcttggatcggataccgagtttt |
32094757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0217 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0217
Description:
Target: scaffold0217; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 7369 - 7302
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
7369 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccaagttttaaaaaaa |
7302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 5e-16; HSPs: 30)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 21603371 - 21603438
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
21603371 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttaaaaaaa |
21603438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 2639471 - 2639411
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
2639471 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
2639411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 4718786 - 4718846
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
4718786 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
4718846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 8765586 - 8765526
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
8765586 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
8765526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 86
Target Start/End: Original strand, 28193615 - 28193683
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaat |
86 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| ||||| || ||||| |
|
|
| T |
28193615 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttaaaaaaaat |
28193683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 25 - 78
Target Start/End: Complemental strand, 34237708 - 34237655
Alignment:
| Q |
25 |
cggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
34237708 |
cggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
34237655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 2618327 - 2618387
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||||||||||||||| || |||||| |
|
|
| T |
2618327 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggattccgagtttt |
2618387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 10292195 - 10292255
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||| | ||||||||||||| ||||| |||||| |
|
|
| T |
10292195 |
aagtgggcggtgggattggtcccttcggattagttgattcttggatcgaataccgagtttt |
10292255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 14633095 - 14633155
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| | |||||| ||||||||||||||||||||| |||||| |
|
|
| T |
14633095 |
aagtgggcggtgggattggtccccttggattagtcgattcttggatcggataccaagtttt |
14633155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 32879420 - 32879480
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||| ||||||| |||||| |
|
|
| T |
32879420 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggattggataccgagtttt |
32879480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 33747023 - 33747083
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||| |||||| || |||||||| ||||| ||||||||||||||| |||||| |
|
|
| T |
33747023 |
aagtggacggtggaattggttctctcggattagtcgatccttggatcggataccgagtttt |
33747083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 39349397 - 39349457
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
39349397 |
aagtgggcggtgggattgatcccctcggattagtcgattcttggatcggataccaagtttt |
39349457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 42328145 - 42328205
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||| |||||||||||| ||| |||| ||||||||||||||||||||| |||||| |
|
|
| T |
42328145 |
aagtggacgatgggattggtcccctcgaattagtcgattcttggatcggataccgagtttt |
42328205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 27 - 78
Target Start/End: Complemental strand, 3734674 - 3734623
Alignment:
| Q |
27 |
gtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
3734674 |
gtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
3734623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 18128654 - 18128721
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| |||||||||||||||| || ||||| ||| ||||||||||| ||||| |||||||| |||| |
|
|
| T |
18128654 |
aagtgggcggtgggattggtcctctcagattagtcggttcttggatcgaataccgagttttaaaaaaa |
18128721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 79
Target Start/End: Complemental strand, 42643178 - 42643117
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttta |
79 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||| | ||||||||||||||||||| ||||||| |
|
|
| T |
42643178 |
aagtgggcggtgggattggtcccctcgcattagttgattcttggatcggataccgagtttta |
42643117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 6953060 - 6953001
Alignment:
| Q |
25 |
cggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
||||||||||||||| | ||||||| ||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
6953060 |
cggtgggattggtccct-cggattagtcgattcttggatcgaataccgagttttaaaaaaa |
6953001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 20306049 - 20306109
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||| ||||| ||||||||||||||| |||||| |
|
|
| T |
20306049 |
aagtgggcggtgggattggtcccctcgaattagtcgatccttggatcggataccgagtttt |
20306109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 21092682 - 21092742
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||| ||||| ||||||||||||||| |||||| |
|
|
| T |
21092682 |
aagtgggcggtgggattggtcccctcgaattagtcgatccttggatcggataccgagtttt |
21092742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 7558011 - 7557952
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttt |
77 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| |||||| ||| |||||||||| ||||| |
|
|
| T |
7558011 |
aagtggacggtgggattggtcccctcgaattagtcgatttttgcatcggataccgagttt |
7557952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 20470058 - 20470124
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||||| | | ||||||| |||||| |||||||||||||| |||||||| |||| |
|
|
| T |
20470058 |
aagtgggcggtgggattggttcct-cggattagtcgatttttggatcggataccgagttttaaaaaaa |
20470124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 25248488 - 25248554
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||| || ||||||||||| |||||||| |||| |
|
|
| T |
25248488 |
aagtgggcggtgggattggtcccctcggattagtcgatt-tttgatcggataccgagttttaaaaaaa |
25248554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 32 - 78
Target Start/End: Original strand, 9713609 - 9713655
Alignment:
| Q |
32 |
attggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
9713609 |
attggtccactcggattagtcgattcttggatcggataccgagtttt |
9713655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 25 - 78
Target Start/End: Complemental strand, 4698776 - 4698723
Alignment:
| Q |
25 |
cggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||||| |||||||| ||||||| ||||| ||||||| |||||| |
|
|
| T |
4698776 |
cggtgggattggtcccctcggattagtcgattcatggattggataccgagtttt |
4698723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 19471751 - 19471811
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| || |||||||||||| ||| |||| ||||| ||||||||||||||| |||||| |
|
|
| T |
19471751 |
aagtgggcgatgggattggtcccctcgaattagtcgatacttggatcggataccgagtttt |
19471811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 19542675 - 19542735
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| || |||||||||||| ||| |||| ||||| ||||||||||||||| |||||| |
|
|
| T |
19542675 |
aagtgggcgatgggattggtcccctcgaattagtcgatacttggatcggataccgagtttt |
19542735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 19590021 - 19589961
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| || |||||||||||| ||| |||| ||||| ||||||||||||||| |||||| |
|
|
| T |
19590021 |
aagtgggcgatgggattggtcccctcgaattagtcgatacttggatcggataccgagtttt |
19589961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 33534627 - 33534567
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||| ||||||||||||| ||||||||| ||| | |||||||||| |||| |||||| |
|
|
| T |
33534627 |
aagtggatcgtgggattggtcccttcggattagtcggtccttggatcggttaccgagtttt |
33534567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 34610747 - 34610687
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| |||| | |||||||| ||| |||| ||||||||||||||||||||| |||||| |
|
|
| T |
34610747 |
aagtgggcggtagaattggtcccctcgaattagtcgattcttggatcggataccgagtttt |
34610687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 34639268 - 34639208
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||| |||||||||| |||| |||||||| | |||| || ||||||| |||||| |
|
|
| T |
34639268 |
aagtggacggtaggattggtcccttcgaattaatcggtccttgaattggataccaagtttt |
34639208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 34)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 21 - 78
Target Start/End: Original strand, 16374138 - 16374195
Alignment:
| Q |
21 |
tggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
16374138 |
tggacggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
16374195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 7275418 - 7275478
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
7275418 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
7275478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 22120029 - 22120089
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
22120029 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
22120089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 31712962 - 31712902
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
31712962 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
31712902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 40542970 - 40542910
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
40542970 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
40542910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 3851898 - 3851965
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||| ||| |||||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
3851898 |
aagtgggcggtgggattgatcccctcggattagtcgattcttggatcggataccgagttttaaaaaaa |
3851965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 17197010 - 17196943
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
17197010 |
aagtgggcggtgggattggtcccctcgaattagtcgattcttggatcggataccgagttttaaaaaaa |
17196943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 25 - 78
Target Start/End: Original strand, 2751419 - 2751472
Alignment:
| Q |
25 |
cggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
2751419 |
cggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
2751472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 21 - 78
Target Start/End: Original strand, 23092240 - 23092297
Alignment:
| Q |
21 |
tggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||| ||||||||||||| |||||| |
|
|
| T |
23092240 |
tggacggtgggattggtcccctcggattagtcgattcatggatcggataccgagtttt |
23092297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 16 - 85
Target Start/End: Original strand, 27009499 - 27009568
Alignment:
| Q |
16 |
caaagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||||||||||||||||||||| || |||| ||||||||||||| ||||||| |||||||| |||| |
|
|
| T |
27009499 |
caaagtggacggtgggattggtcccctcaaattagtcgattcttggattggataccgagttttaaaaaaa |
27009568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 654765 - 654705
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
654765 |
aagtgggcggtgggattggtcccctcggattagtcggttcttggatcggataccgagtttt |
654705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 7175922 - 7175870
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatac |
70 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
7175922 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggatac |
7175870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 11997990 - 11998050
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||| ||||||||||||||||||||| |||||| |
|
|
| T |
11997990 |
aagtgggcggtgggattggtcccctcgaattagtcgattcttggatcggataccgagtttt |
11998050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 21835292 - 21835352
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||||||||||| | |||||| |
|
|
| T |
21835292 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcggatatcgagtttt |
21835352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 22703627 - 22703687
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||| ||||||||||| |||||| |
|
|
| T |
22703627 |
aagtgggcggtgggattggtcccctcggattagtcgattctttgatcggatacccagtttt |
22703687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 27312293 - 27312353
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| || ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
27312293 |
aagtgggcggtgggattggtcccctcagattagtcgattcttggatcggataccgagtttt |
27312353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 42913573 - 42913513
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||||||||||| |||||||| | ||||||| ||||||||||| |||||| |
|
|
| T |
42913573 |
aagtggacggtgggattggtcccctcggattagttgattcttagatcggataccgagtttt |
42913513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 39145712 - 39145645
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| |||||||||| ||| |||||| |||||||| |||| |
|
|
| T |
39145712 |
aagtggacggtgggattggtcccctcgaattagtcgattcttgaatcagataccaagttttaaaaaaa |
39145645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 19 - 85
Target Start/End: Complemental strand, 36772362 - 36772296
Alignment:
| Q |
19 |
agtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
||||| |||||| ||| ||||| |||||||| ||||||||| ||||||||||| |||||||| |||| |
|
|
| T |
36772362 |
agtgggcggtggaattagtcctctcggattagtcgattctttgatcggataccgagttttaaaaaaa |
36772296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 29 - 86
Target Start/End: Original strand, 22696473 - 22696530
Alignment:
| Q |
29 |
gggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaat |
86 |
Q |
| |
|
|||||||||||| |||||||| ||| | ||||||||||||||| |||||||| ||||| |
|
|
| T |
22696473 |
gggattggtcctctcggattagtcggtccttggatcggataccgagttttaaaaaaat |
22696530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 21217893 - 21217833
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||| ||| |||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
21217893 |
aagtgggcggtgggattgatcccctcggattagttgattcttggatcggataccgagtttt |
21217833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 71
Target Start/End: Complemental strand, 25102864 - 25102816
Alignment:
| Q |
23 |
gacggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
||||||||||||||| | ||||||||| |||||||||||||| |||||| |
|
|
| T |
25102864 |
gacggtgggattggttccttcggattagtcgattcttggatcagatacc |
25102816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 28089960 - 28090020
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| || || ||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
28089960 |
aagtgggcgatgagattggtcccctcggattagtcgattcttggatcggataccgagtttt |
28090020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 31197731 - 31197791
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| || ||||| ||||||||||||||||||| | |||||| |
|
|
| T |
31197731 |
aagtggtcggtgggattggtcccctcagattagtcgattcttggatcggatatcgagtttt |
31197791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 18044256 - 18044315
Alignment:
| Q |
26 |
ggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
||||| |||||||| || ||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
18044256 |
ggtggaattggtcccctcagattagtcgattcttggatcggataccgagttttaaaaaaa |
18044315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 25333544 - 25333610
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| | ||||||||||||| |||||||| ||||||||||||||||| ||| |||||||| |||| |
|
|
| T |
25333544 |
aagtgggcagtgggattggtcccctcggattagtcgattcttggatcgga-accgagttttaaaaaaa |
25333610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 32849732 - 32849791
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttt |
77 |
Q |
| |
|
|||||| | ||||||||||||| || ||||| ||||||||||||||||||||| ||||| |
|
|
| T |
32849732 |
aagtgggcagtgggattggtcccctcagattagtcgattcttggatcggataccgagttt |
32849791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 25 - 78
Target Start/End: Original strand, 2344447 - 2344500
Alignment:
| Q |
25 |
cggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||||| |||||||| ||| | ||||||||||||||| |||||| |
|
|
| T |
2344447 |
cggtgggattggtcccctcggattagtcggtccttggatcggataccgagtttt |
2344500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 71
Target Start/End: Original strand, 17212202 - 17212247
Alignment:
| Q |
26 |
ggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
17212202 |
ggtgggattggtcccctcggattagtcgattcttggatcagatacc |
17212247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 43785359 - 43785306
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
|||||||||||| ||||||||| | |||||| |||||| |||||||||||||| |
|
|
| T |
43785359 |
aagtggacggtgagattggtccccttggattagtcgatttttggatcggatacc |
43785306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 22643402 - 22643342
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||| |||| |||| |||||||||||||||||| |||| |||||| |||||| |
|
|
| T |
22643402 |
aagtggccggtgtgattagtcccctcggattaatcgattctttgatcagataccaagtttt |
22643342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 29861811 - 29861871
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||| ||| ||| |||| ||||||||| ||||||||||| |||||| |
|
|
| T |
29861811 |
aagtgggcggtgggattgatcccctcgaattagtcgattcttagatcggataccgagtttt |
29861871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 27 - 71
Target Start/End: Original strand, 36395496 - 36395540
Alignment:
| Q |
27 |
gtgggattggtcctttcggattaatcgattcttggatcggatacc |
71 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||||||| ||||||| |
|
|
| T |
36395496 |
gtggaattggtcctctcggattagtcgattcttggattggatacc |
36395540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 45 - 85
Target Start/End: Complemental strand, 41907547 - 41907507
Alignment:
| Q |
45 |
gattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
41907547 |
gattagtcgattcttggatcggataccgagttttaaaaaaa |
41907507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0576 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0576
Description:
Target: scaffold0576; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 25 - 78
Target Start/End: Complemental strand, 5135 - 5082
Alignment:
| Q |
25 |
cggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
5135 |
cggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
5082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 8511 - 8451
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||| ||||||||||| |||||| |
|
|
| T |
8511 |
aagtgggcggtgggattggtccgctcggattagtcgattcttagatcggataccgagtttt |
8451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 39229 - 39289
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
39229 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcagataccgagtttt |
39289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 40462 - 40521
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| | ||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
40462 |
aagtgggcggtgggattggtccct-cggattagtcgattcttggatcggataccgagtttt |
40521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0020 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0020
Description:
Target: scaffold0020; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 26 - 86
Target Start/End: Complemental strand, 123117 - 123058
Alignment:
| Q |
26 |
ggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaat |
86 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
123117 |
ggtgggattggtcccctcggattaatcgat-cttggatcggataccaagttttaaaaaaat |
123058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 161946 - 162006
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
161946 |
aagtgggcggtgggattggtcccctcggattagtcgattcttggatcagataccgagtttt |
162006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 13107 - 13040
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||||||||||||||| ||| || ||||| | ||||||||||||||||||| |||||||| |||| |
|
|
| T |
13107 |
aagtggacggtgggattgatcccctcagattagttgattcttggatcggataccgagttttaaaaaaa |
13040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 66891 - 66958
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||| | ||||||||||||||| |||||||| |||| |
|
|
| T |
66891 |
aagtgggcggtgggattggtcccctcggattagtcggtccttggatcggataccgagttttaaaaaaa |
66958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 78
Target Start/End: Complemental strand, 52929 - 52871
Alignment:
| Q |
20 |
gtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||| |||| ||||||||||| |||||||| |||||||||| |||||||||| |||||| |
|
|
| T |
52929 |
gtgggcggtaggattggtcctctcggattagtcgattcttgaatcggataccgagtttt |
52871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0623 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0623
Description:
Target: scaffold0623; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 1116 - 1057
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| ||||||||| ||||||||||| |||||| |
|
|
| T |
1116 |
aagtggacggtgggattggtcccctcgaattagtcgattctt-gatcggataccgagtttt |
1057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 9359 - 9300
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| ||||||||| ||||||||||| |||||| |
|
|
| T |
9359 |
aagtggacggtgggattggtcccctcgaattagtcgattctt-gatcggataccgagtttt |
9300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 97426 - 97359
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagttttaataaaa |
85 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||| ||| || ||||| |||||||| |||||||| |||| |
|
|
| T |
97426 |
aagtgggcggtgggattggtcctctcgtattagtcggtttttggaccggataccgagttttaaaaaaa |
97359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 10754 - 10695
Alignment:
| Q |
18 |
aagtggacggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| || |||||| ||||||||||| |||||| |
|
|
| T |
10754 |
aagtggacggtgggattggtcccctcgaattagtcaattctt-gatcggataccgagtttt |
10695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 78
Target Start/End: Original strand, 32433 - 32484
Alignment:
| Q |
26 |
ggtgggattggtcctttcggattaatcgattcttggatcggatacctagtttt |
78 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| ||||||||||| |||||| |
|
|
| T |
32433 |
ggtgggattggtcccctcggattagtcgattctt-gatcggataccgagtttt |
32484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University