View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3101_low_22 (Length: 281)
Name: NF3101_low_22
Description: NF3101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3101_low_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 18 - 130
Target Start/End: Complemental strand, 32679752 - 32679640
Alignment:
| Q |
18 |
ttttacatgatatttgagataacaaacaagtattgttggttttcatcctttgtgggttgtacctgacttctaaaccttttcatcctttatggttgtacct |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32679752 |
ttttacatgatatttaagataacaaacaagtattgttggttttcatcctttatgggttgtacctgacttctaaaccttttcatcctttatggttgtacct |
32679653 |
T |
|
| Q |
118 |
gacttctaaacct |
130 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32679652 |
gacttctaaacct |
32679640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 57 - 104
Target Start/End: Complemental strand, 32679676 - 32679630
Alignment:
| Q |
57 |
ttttcatcctttgtgggttgtacctgacttctaaaccttttcatcctt |
104 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32679676 |
ttttcatcctttatgg-ttgtacctgacttctaaaccttttcatcctt |
32679630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 96 - 175
Target Start/End: Original strand, 2230576 - 2230655
Alignment:
| Q |
96 |
ttcatcctttatggttgtacctgacttctaaacctatcaccggaggccttaagttttttcatatccacatattattattc |
175 |
Q |
| |
|
|||||||||| || ||||||||| |||||||||| |||||| ||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
2230576 |
ttcatcctttttgattgtacctggcttctaaaccaatcaccagaggccttaagtttttttatatccatatattattattc |
2230655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 199 - 267
Target Start/End: Original strand, 2230704 - 2230772
Alignment:
| Q |
199 |
ttttgttttgctccttaatcttaggtcttttattacttgggcgagctgaatgattcattatcctatgcc |
267 |
Q |
| |
|
|||| ||| ||||||| ||||||||||||| |||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
2230704 |
ttttttttcgctcctttatcttaggtctttaattacttgggcgagctgaatgactcactatcctatgcc |
2230772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 177 - 267
Target Start/End: Original strand, 44806913 - 44807003
Alignment:
| Q |
177 |
tggtttgtgttttggcatctgattttgttttgctccttaatcttaggtcttttattacttgggcgagctgaatgattcattatcctatgcc |
267 |
Q |
| |
|
|||||||| |||| | |||||||||| || ||||||| |||||||||||||||||||||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
44806913 |
tggtttgtattttagtatctgatttttcttcgctcctttatcttaggtcttttattacttgggcgagttgaatgactcactatcctatgcc |
44807003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 95 - 162
Target Start/End: Original strand, 44806806 - 44806873
Alignment:
| Q |
95 |
tttcatcctttatggttgtacctgacttctaaacctatcaccggaggccttaagttttttcatatcca |
162 |
Q |
| |
|
|||||| |||| || ||||||| | |||||||||| |||||| |||| |||||||||||||||||||| |
|
|
| T |
44806806 |
tttcattctttttgattgtacccggcttctaaaccaatcaccagaggacttaagttttttcatatcca |
44806873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 177 - 267
Target Start/End: Complemental strand, 28135930 - 28135839
Alignment:
| Q |
177 |
tggtttgtgttttggc-atctgattttgttttgctccttaatcttaggtcttttattacttgggcgagctgaatgattcattatcctatgcc |
267 |
Q |
| |
|
||||||||||||| | |||| ||||| ||| ||||||| ||||||||| |||||||||||||| ||||||||||| ||| ||||||||||| |
|
|
| T |
28135930 |
tggtttgtgtttttactatctaattttttttcgctcctttatcttaggtattttattacttgggtgagctgaatgactcactatcctatgcc |
28135839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 28136075 - 28136025
Alignment:
| Q |
18 |
ttttacatgatatttgagataacaaacaagtattgttggttttcatccttt |
68 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
28136075 |
ttttacatgatatttgagataacaaataagtattgttggctttcatccttt |
28136025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 95 - 175
Target Start/End: Complemental strand, 28136035 - 28135955
Alignment:
| Q |
95 |
tttcatcctttatggttgtacctgacttctaaacctatcaccggaggccttaagttttttcatatccacatattattattc |
175 |
Q |
| |
|
||||||||||| | ||||||| | |||||||||| |||||| ||| ||||| |||||||||||||| |||||||||||| |
|
|
| T |
28136035 |
tttcatccttttttattgtacccggcttctaaaccaatcaccagagtccttatgttttttcatatccctatattattattc |
28135955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University