View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3101_low_23 (Length: 280)
Name: NF3101_low_23
Description: NF3101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3101_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 27473734 - 27473613
Alignment:
| Q |
1 |
gatcatgtatagaagggtaaggaaagaaatttgagattacaatgataaatgcattttcaaaatcaatagcaagaaaggtccactatatttcttgtgttct |
100 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27473734 |
gatcatgtatagaaggataagtaaagaaatttgagattgcaatgataaatgcattttcaaaatcaatagcaagaaaggtccactatatttcttgtgttct |
27473635 |
T |
 |
| Q |
101 |
atcatgtaagcatacattaact |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
27473634 |
atcatgtaagcatacattaact |
27473613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 19856099 - 19856029
Alignment:
| Q |
1 |
gatcatgtatagaagggtaaggaaagaaatttgagattacaatgataaatgcattttcaaaatcaatagca |
71 |
Q |
| |
|
||||||| |||||||| ||| || |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19856099 |
gatcatgcatagaaggataaataatgaaatttgagattacaatgagaaatgcattttcaaaatcaatagca |
19856029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University