View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3101_low_29 (Length: 229)
Name: NF3101_low_29
Description: NF3101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3101_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 34056365 - 34056455
Alignment:
| Q |
8 |
gacatcatcaacaatctgtcgttaagaaaacttggattgtaagttacctcctctgctagcaccaaattaaattaagttgaaagtgcattcc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34056365 |
gacatcatcaacaatctgtcgttaagaaaacttggattgtaagttacctcctctgctagcaccaaattaaattaagttgaaagtgcattcc |
34056455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 149 - 229
Target Start/End: Original strand, 34056505 - 34056585
Alignment:
| Q |
149 |
gctgagtacgaatattagttggatcagcacccaaattttcaagaacacatgctgccacaccctcaccctcgcgaagaaaac |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34056505 |
gctgagtacgaatattagttggatcagcacccaaattttcaagaacaggtgctgccacaccctcaccctcgcgaagaaaac |
34056585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 157 - 226
Target Start/End: Complemental strand, 47379671 - 47379602
Alignment:
| Q |
157 |
cgaatattagttggatcagcacccaaattttcaagaacacatgctgccacaccctcaccctcgcgaagaa |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||| |
|
|
| T |
47379671 |
cgaatattagttggatcagcacccaaattttcaagaacacgtgcggccacaccctcaccctctcgaagaa |
47379602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 157 - 226
Target Start/End: Complemental strand, 47815202 - 47815133
Alignment:
| Q |
157 |
cgaatattagttggatcagcacccaaattttcaagaacacatgctgccacaccctcaccctcgcgaagaa |
226 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||| |||||||||||| |||||||| ||||||| |
|
|
| T |
47815202 |
cgaatattagttggatcatcgcccaaattttcaagaacacgtgctgccacaccttcaccctctcgaagaa |
47815133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 67
Target Start/End: Complemental strand, 47815478 - 47815423
Alignment:
| Q |
12 |
tcatcaacaatctgtcgttaagaaaacttggattgtaagttacctcctctgctagc |
67 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47815478 |
tcatcaacaatctgtcattaagaaaactaggattgtaagttacctcctctgctagc |
47815423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 67
Target Start/End: Complemental strand, 47380020 - 47379965
Alignment:
| Q |
12 |
tcatcaacaatctgtcgttaagaaaacttggattgtaagttacctcctctgctagc |
67 |
Q |
| |
|
|||| ||||||||||| || |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47380020 |
tcattaacaatctgtcattgagaaaactaggattgtaagttacctcctctgctagc |
47379965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 226
Target Start/End: Complemental strand, 45111893 - 45111824
Alignment:
| Q |
157 |
cgaatattagttggatcagcacccaaattttcaagaacacatgctgccacaccctcaccctcgcgaagaa |
226 |
Q |
| |
|
||||||||||| |||||||| || | ||||||||||||| |||||| || ||||||||||| ||||||| |
|
|
| T |
45111893 |
cgaatattagtaggatcagcgcctaggttttcaagaacacgtgctgctactccctcaccctctcgaagaa |
45111824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 157 - 226
Target Start/End: Complemental strand, 40242767 - 40242698
Alignment:
| Q |
157 |
cgaatattagttggatcagcacccaaattttcaagaacacatgctgccacaccctcaccctcgcgaagaa |
226 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||| |||||||||||| |||||||| ||||||| |
|
|
| T |
40242767 |
cgaatattagttgggtcggcacccaaattttcaagaacacgtgctgccacaccttcaccctctcgaagaa |
40242698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 11 - 67
Target Start/End: Complemental strand, 40243063 - 40243006
Alignment:
| Q |
11 |
atcatcaacaatctgtcgttaagaaaacttgga-ttgtaagttacctcctctgctagc |
67 |
Q |
| |
|
|||||| |||||||||| | ||||||||| || |||||||||||||||||||||||| |
|
|
| T |
40243063 |
atcatctacaatctgtcatgaagaaaactacgaattgtaagttacctcctctgctagc |
40243006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 67
Target Start/End: Complemental strand, 17717221 - 17717166
Alignment:
| Q |
12 |
tcatcaacaatctgtcgttaagaaaacttggattgtaagttacctcctctgctagc |
67 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
17717221 |
tcatcaacaatctgtcattaagaaaactaggattgtaagttacctcctccgctagc |
17717166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University