View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3103-INSERTION-1 (Length: 268)
Name: NF3103-INSERTION-1
Description: NF3103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3103-INSERTION-1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 8 - 266
Target Start/End: Original strand, 39951839 - 39952096
Alignment:
| Q |
8 |
ctgttctaggtatttttgggattacgtagaaaggaaacaacttgaatggtctgtgtcaagtgaatggtctccaaatggatgctatttcatgacagcaacc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39951839 |
ctgttctaggtatttttgggattacgtagaaaggaaacaacttgaatggtctgtgtcaagtgaatggtctccaaatgggtgctatttcatgacagcaacc |
39951938 |
T |
|
| Q |
108 |
acaacaccgaggcttcaagttgataatgggtatgatccactcattgcctgaaaatattcaatcgtttatctttatccatgggcactctgattttgttgtt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39951939 |
acaacaccgaggcttcaagttgataatgggtatgatctactcattgcctgaaaatattcaatcgtttatctttatccatgggcactctgattttgttgtt |
39952038 |
T |
|
| Q |
208 |
aaaaatatgtattagatttaaattatgttgagcaaatatctcttgattatgtttgttga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39952039 |
-aaaatatgtattagatttaaattatgttgagcaaatatctcttgattatgtttgttga |
39952096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 50 - 208
Target Start/End: Complemental strand, 34230769 - 34230589
Alignment:
| Q |
50 |
tgaatggtctgtgtcaagtgaatggtctccaaatggatgctatttcatgacagcaaccacaacaccgaggcttcaagttgataatgggta---------- |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| ||| | || ||||||||||||||||||||||| |
|
|
| T |
34230769 |
tgaatggtctgtgtcaagtgaatggtctccagatgggtgctatttcatgacagcaacaacagctccaaggcttcaagttgataatgggtatgtctttcca |
34230670 |
T |
|
| Q |
140 |
------------tgatccactcattgcctgaaaatattcaatcgtttatctttatccatgggcactctgattttgttgtta |
208 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34230669 |
ctggtggggccttgatctactcattgcctgaaaatattcaattgtttatctttatccatgggcactctgattatgttgtta |
34230589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 209 - 265
Target Start/End: Complemental strand, 34230522 - 34230466
Alignment:
| Q |
209 |
aaaatatgtattagatttaaattatgttgagcaaatatctcttgattatgtttgttg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34230522 |
aaaatatgtattagatttaaattatgttgagtaaatatctcttgattatgtttgttg |
34230466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 160 - 209
Target Start/End: Original strand, 30339345 - 30339394
Alignment:
| Q |
160 |
aatattcaatcgtttatctttatccatgggcactctgattttgttgttaa |
209 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30339345 |
aatattcaattgtttatctttatccatgggcactctgattttgttgttaa |
30339394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University