View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3103-INSERTION-4 (Length: 121)
Name: NF3103-INSERTION-4
Description: NF3103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3103-INSERTION-4 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 3e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 8 - 121
Target Start/End: Original strand, 38053272 - 38053385
Alignment:
| Q |
8 |
aagtgcataccaatttgttttctttccaccatttaattagatagaaaataaaggtctaaataagtaggggaccgtctcctgatatgtatgtaactcgctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38053272 |
aagtgcataccaatttgttttctttccaccatttaattagatagaaaataaaggtctaaataagtaggggaccgtctcctgatatgtatgtaactcgctt |
38053371 |
T |
|
| Q |
108 |
gaggtttagcatgt |
121 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
38053372 |
gaggtttagcatgt |
38053385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 29 - 76
Target Start/End: Original strand, 38053484 - 38053531
Alignment:
| Q |
29 |
ctttccaccatttaattagatagaaaataaaggtctaaataagtaggg |
76 |
Q |
| |
|
|||||||| |||||| |||||||||||||| | | ||||||||||||| |
|
|
| T |
38053484 |
ctttccactatttaaatagatagaaaataatgatataaataagtaggg |
38053531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University