View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3103-INSERTION-5 (Length: 103)
Name: NF3103-INSERTION-5
Description: NF3103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3103-INSERTION-5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 55; Significance: 4e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 4e-23
Query Start/End: Original strand, 21 - 99
Target Start/End: Complemental strand, 34329904 - 34329826
Alignment:
| Q |
21 |
ttctctttccatccaaattttttcggataaacgtcgcaacactcagataacccttcttttattttgcataccaaatcct |
99 |
Q |
| |
|
|||| ||||| ||||||| |||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34329904 |
ttctttttccctccaaatatttttggataaacgtcacaacattcagataacccttcttttattttgcataccaaatcct |
34329826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 5e-16; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 5e-16
Query Start/End: Original strand, 40 - 94
Target Start/End: Original strand, 36621854 - 36621908
Alignment:
| Q |
40 |
ttttcggataaacgtcgcaacactcagataacccttcttttattttgcataccaa |
94 |
Q |
| |
|
|||| ||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36621854 |
ttttaggataaacgtcacaacattcagataacccttcttttattttgcataccaa |
36621908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.0000000000005
Query Start/End: Original strand, 45 - 94
Target Start/End: Original strand, 36632659 - 36632708
Alignment:
| Q |
45 |
ggataaacgtcgcaacactcagataacccttcttttattttgcataccaa |
94 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36632659 |
ggataaacgttacaacactcagataacccttcttttattttgcagaccaa |
36632708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 36627087 - 36627139
Alignment:
| Q |
45 |
ggataaacgtcgcaacactcagataacccttcttttattttgcataccaaatc |
97 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||| | ||| |||||||| |
|
|
| T |
36627087 |
ggataaacgttacaacattcagataacccttcttttatctggcagaccaaatc |
36627139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.000000008
Query Start/End: Original strand, 27 - 97
Target Start/End: Original strand, 45306467 - 45306537
Alignment:
| Q |
27 |
ttccatccaaattttttcggataaacgtcgcaacactcagataacccttcttttattttgcataccaaatc |
97 |
Q |
| |
|
|||| ||||||| |||| ||||| | ||| ||| | ||||||||||| | ||||||||||||||||||||| |
|
|
| T |
45306467 |
ttccctccaaatatttttggatagaagtcacaaaattcagataacccctgttttattttgcataccaaatc |
45306537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University