View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3103-INSERTION-6 (Length: 297)
Name: NF3103-INSERTION-6
Description: NF3103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3103-INSERTION-6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 7 - 168
Target Start/End: Complemental strand, 45147778 - 45147617
Alignment:
| Q |
7 |
aaatccgacatgagttttagaatgagaagtattgcctacctctttgttccaattggttttgtaaagtatcaccgagagcagcaaggtctggaggagaatt |
106 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45147778 |
aaatccaacatgagtcttagaatgagaagtattgcctacctctttgttccaattggttttgtaaagtatccccgagagcagcaaggtctggaggagaatt |
45147679 |
T |
|
| Q |
107 |
ccacatatcatacctccccaaagtccctnnnnnnnttcagaatcattataaagagttgttcg |
168 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
45147678 |
ccacatatcatacctccccaaagtccctaaaaaaattcagaatcattagaaagagttgttcg |
45147617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 206 - 297
Target Start/End: Complemental strand, 45147579 - 45147488
Alignment:
| Q |
206 |
acctataaaacagtcaatgagtctttggatagaaatgtttatcaaaaagaggcattaaagcaggaaccattcatgacattaacatttttcac |
297 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45147579 |
acctataaaacggtcaatgagtctttggatagaaatgtttatcaaaaagaggcattaaagcaggaaccattcatgacattaacatttttcac |
45147488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University