View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3103-INSERTION-8 (Length: 301)
Name: NF3103-INSERTION-8
Description: NF3103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3103-INSERTION-8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 6 - 301
Target Start/End: Original strand, 30943108 - 30943403
Alignment:
| Q |
6 |
caggttgtgtggtggttcaattgtaggatctattgctccacatcaagcttttgcaattggtggtcccaacagtgtaagaggctatggtgaaggtgcagtt |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30943108 |
caggttgagtggtggttcaattgtaggatctatcgctccacatcaagcttttgcaattggtggtcccaacagtgttagaggctatggtgaaggtgcagtt |
30943207 |
T |
|
| Q |
106 |
ggttctggacaatcgtatttggcatcaaaaactgaattggcaatcccattggtatatataataatgctcattattccttatttggcatgatactgataaa |
205 |
Q |
| |
|
||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30943208 |
ggttctggacagtcatatttggcatctaaaactgaattggcaatcccattggtatatataataatgctcattattccttatttggcatgatactgataaa |
30943307 |
T |
|
| Q |
206 |
aataatgaaacatagatatgtgagtcatttctaacattatcaatcctaccaatcattgatgccatgctgaccatgttctttactcaattcttgcag |
301 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30943308 |
aataatgaaacatatgtatgtgagtcatttctaacattatcaatcctaccaatcattgatgccatgctgaccatgttctttactcaattcttgcag |
30943403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University