View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3103_high_26 (Length: 396)
Name: NF3103_high_26
Description: NF3103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3103_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 288 - 380
Target Start/End: Complemental strand, 28211175 - 28211083
Alignment:
| Q |
288 |
aatcacgtggctcccacttctctctctacccataactatagaaaccaaacaatttctctgaacttcccgtaaatgcttatcggcgatggcatc |
380 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28211175 |
aatcaagtggctcccacttctctctctacccataagtatagaaaccaaacaatttctctgaacttcccgtaaatgcttatcggcgatggcatc |
28211083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 54 - 110
Target Start/End: Original strand, 38505971 - 38506028
Alignment:
| Q |
54 |
ttctccatttctttcaaattctttttcgaaaa-gccaaaacatttcttccaatgattt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
38505971 |
ttctccatttctttcaaattctttttcgaaaaggacaaaacatttctttcaatgattt |
38506028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University