View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3103_high_40 (Length: 327)
Name: NF3103_high_40
Description: NF3103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3103_high_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 295; Significance: 1e-166; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 311
Target Start/End: Original strand, 3668692 - 3669002
Alignment:
| Q |
1 |
attatacctgcttgcaacaattctaccttgtttcaacgatttcttcactgatttttcaccttcaaacagtttcttcggttgaacctgagcaatttcttca |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3668692 |
attataccggcttgcaacaattctaccttgtttcaacgatttcttcactgatttttcaccttcaaacagcttcttcggttgaacctgagcaatttcttca |
3668791 |
T |
|
| Q |
101 |
tctttcttcttcacacgcttaatcgatccaaccgcagaattaactgaatttgaattcaaattcaaattcggtttgcaaatcgtttttcttcgattttctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3668792 |
tctttcttcttcacacgcttaatcgatccaaccgcagaattaactgaatttgaattcaaattcaaattcggtttgcaaatcgtttttcttcgattttctt |
3668891 |
T |
|
| Q |
201 |
cacaattttcttgcggtttcaaaaaacaagatttcctcctattcaccgtcgccggagtaatccccgacggcattacttcacaactttcctgcggtttcca |
300 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3668892 |
cacaactttcttgaggtttcaaaaaacaagatttcctcctattcaccgtcgccggagtaatccccgacggcattacttcacaactttcctgcggtttcca |
3668991 |
T |
|
| Q |
301 |
gaaacaagact |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
3668992 |
gaaacaagact |
3669002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 198 - 262
Target Start/End: Original strand, 3668967 - 3669031
Alignment:
| Q |
198 |
cttcacaattttcttgcggtttcaaaaaacaagatttcctcctattcaccgtcgccggagtaatc |
262 |
Q |
| |
|
|||||||| |||| ||||||||| | |||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
3668967 |
cttcacaactttcctgcggtttccagaaacaagacttcctccgattcaccgtcgccggagtaatc |
3669031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University