View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3103_high_44 (Length: 274)
Name: NF3103_high_44
Description: NF3103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3103_high_44 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 11 - 274
Target Start/End: Original strand, 36573152 - 36573415
Alignment:
| Q |
11 |
cagagaaaaaagcaagagcaccaacaaaaggtgcattaatataagttgctggttctgactgttgataattatttctatcatcagagaaattgtcactgct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36573152 |
cagagaaaaaagcaagagcaccaacaaaaggtgcattaatataagttgctggttctgactgttgataattatttctatcatcagagaaattgtcactgct |
36573251 |
T |
 |
| Q |
111 |
atcaggaccaccaacaatggctccaacaagaacatttggattaggtgaaccagaatgacgatattgaaatccattgttgcaagaaatctgttgaggctgc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36573252 |
atcaggaccaccaacaatggctccaacaagaacatttggattaggtgaaccagaatgaagatattgaaatccattgttgcaagaaatctgttgaggctgc |
36573351 |
T |
 |
| Q |
211 |
acgcgaatggacggtaaagaagaacctctatggtgaatatgttttggatatttctctccaaaac |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36573352 |
acgcgaatggacggtaaagaagaacctctatggtgaatatgttttggatatttctctccaaaac |
36573415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University