View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3103_high_61 (Length: 235)
Name: NF3103_high_61
Description: NF3103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3103_high_61 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 17 - 213
Target Start/End: Complemental strand, 42272470 - 42272274
Alignment:
| Q |
17 |
cacagacagacagaattccagaacaagataagaccactattttacaactacattggttaacacnnnnnnnncacaaacctatgacaaaaggttgtctata |
116 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42272470 |
cacaaacagacagaattccagaacaagataagaccactattttacaactacattggttaacacaaaaaaaacacaaacctatgacaaaaggttgtctata |
42272371 |
T |
 |
| Q |
117 |
ctcatcaaatgcagaagtggttggttcctcagtgccagcctttctttgctctaatccattatccatatgaaatccagaaaaatgaacctcagttgaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42272370 |
ctcatcaaatgcagaagtggttggttcctcggtgccagcttttctttgctctaatccattatccatatgaaatccagaaaaatgaacctcagttgaa |
42272274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University