View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3103_high_63 (Length: 232)
Name: NF3103_high_63
Description: NF3103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3103_high_63 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 51770508 - 51770735
Alignment:
| Q |
1 |
atatcttcattgttacttgttacatggtctacgatggagcagtacctaaatattattaaaaactttagcaatgatgaactcttcttaaaagtagaaactc |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51770508 |
atatctccattgttacttgttacatggtctacgatggagcagtacctaaatattattaaaaactttagcaatgatgaactcttcttagaagtagaa---- |
51770603 |
T |
|
| Q |
101 |
acggtcttcattgttgatataattgagacaatgctgatgttgctttacacaaaaactagaagaagnnnnnnntattagttaggttttgagtcgttttctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
51770604 |
acggtcttcattgttgatataattgagacaatgctgatgttgctttacacaaaaactagaagaagaaaaaaatattagttaggttttgagtcgttttctt |
51770703 |
T |
|
| Q |
201 |
cnnnnnnnncgaactggtatcgaccaagtcaa |
232 |
Q |
| |
|
| |||||| |||||||||||||||| |
|
|
| T |
51770704 |
cttttttttcgaactagtatcgaccaagtcaa |
51770735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University