View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3103_high_67 (Length: 214)
Name: NF3103_high_67
Description: NF3103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3103_high_67 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 21 - 214
Target Start/End: Original strand, 43408095 - 43408288
Alignment:
| Q |
21 |
aatggaatgcactgctccagcagcaaatcatgatgatcagcaggaaagtggttttgttgttgggaagagatggtggattgggcctagggcaaatccaggt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408095 |
aatggaatgcactgctccagcagcaaatcatgatgatcagcaggaaagtggttttgttgttgggaagagatggtggattgggcctagggcaaatccaggt |
43408194 |
T |
 |
| Q |
121 |
ccaacaacatctgtcaaagaaagattagtggttgctgttggttacttaaaagagtacacaaagaactcatccaacaacgtccttattcagatat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408195 |
ccaacaacatctgtcaaagaaagattagtggttgctgttggttacttaaaagagtacacaaagaactcatccaacaacgtccttattcagatat |
43408288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University