View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3103_low_56 (Length: 244)
Name: NF3103_low_56
Description: NF3103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3103_low_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 226
Target Start/End: Original strand, 21532042 - 21532255
Alignment:
| Q |
13 |
aaaatcgatttttggaagatcccagttagtgtaatcatttggcctgtggaaatttaaaattgggagcatgtgaaaactgttatttttcaaacgtaacatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21532042 |
aaaatcgatttttggaagatcccagttagtgtaatcatttggcctgtggaaatttaaaattgggagcatgtgaaaactgttatttttcaaacgtaacatt |
21532141 |
T |
 |
| Q |
113 |
atcatgtgtgtccataaaattaaacccccgagacagattttgtgttcgttggacacttgtttggttcatggtttcactccaaggtattacgtacgatcaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21532142 |
atcatgtgtgtccataaaattaaacccccgagacagattttgtgttcattggacacttgtttggttcatggtttcactccaaggtattacgtacgatcaa |
21532241 |
T |
 |
| Q |
213 |
ctccaaggtattgg |
226 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
21532242 |
ctccaaggtattgg |
21532255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University