View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3103_low_72 (Length: 230)
Name: NF3103_low_72
Description: NF3103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3103_low_72 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 35901553 - 35901776
Alignment:
| Q |
1 |
ccatttgcgccgcatcgcttatattcctcaatctatatttaacaatttaacttttgctcccacttccaattcttcagaattaaagatacatagaatgagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35901553 |
ccatttgcgccgcatcgcttatattcctcaatctatattcaacaatttaacttttgctcccacttccaactcttcagaattaaagatacatagaatgagc |
35901652 |
T |
|
| Q |
101 |
tttaaagtttcacgttggaggtgttgaacttgtcagagtctgggattgatgatagatcactccagtgatctcaacgagttgctttgggctactgcaactt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35901653 |
tttaaagtttcacgttggaggtgttgaacttgtcagagtctgggattgatgatagatcactccagtgatctcaacgaattgctttgggctactgcaactt |
35901752 |
T |
|
| Q |
201 |
gacatagaatgttgtgatgatgtc |
224 |
Q |
| |
|
||||||||||||||| |||||||| |
|
|
| T |
35901753 |
gacatagaatgttgttatgatgtc |
35901776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 100 - 202
Target Start/End: Complemental strand, 6006418 - 6006314
Alignment:
| Q |
100 |
ctttaaagtttc-acgttggaggtgttgaacttgtcagagtctgggattgatgatagatcactcca-gtgatctcaacgagttgctttgggctactgcaa |
197 |
Q |
| |
|
|||||||||||| | | ||||| |||| ||||||||| | || || |||||||||||||||||| | |||||||||| |||||||||||||||||||||| |
|
|
| T |
6006418 |
ctttaaagtttccatgctggagatgttaaacttgtcacattccggaattgatgatagatcactctacgtgatctcaatgagttgctttgggctactgcaa |
6006319 |
T |
|
| Q |
198 |
cttga |
202 |
Q |
| |
|
||||| |
|
|
| T |
6006318 |
cttga |
6006314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 166 - 203
Target Start/End: Original strand, 1528279 - 1528316
Alignment:
| Q |
166 |
tgatctcaacgagttgctttgggctactgcaacttgac |
203 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
1528279 |
tgatctcaacgagttgctttgggttactgcatcttgac |
1528316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 166 - 203
Target Start/End: Original strand, 12120218 - 12120255
Alignment:
| Q |
166 |
tgatctcaacgagttgctttgggctactgcaacttgac |
203 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
12120218 |
tgatctcaacgagttgctttgggttactgcatcttgac |
12120255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University