View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3103_low_74 (Length: 215)
Name: NF3103_low_74
Description: NF3103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3103_low_74 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 22 - 199
Target Start/End: Original strand, 2145314 - 2145491
Alignment:
| Q |
22 |
ttaggagatttgagctaggccctagcaatatttcacaaagattcttgttacctttatgcatatatgttttattttgtaaagtcgttacctggtatcatta |
121 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2145314 |
ttaggagattttagctaggccctagcaatatttcacaaagattcttgttacccttatgcatatatgttttattttgtaaagtcattacctggtatcatta |
2145413 |
T |
 |
| Q |
122 |
tgcatgtgtttctatcaatcattgatattgctcccttttctgactctaattgtgctttcattttcttggggaccaatg |
199 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2145414 |
tgcatgtgtttctatcaatcattgttattgctcccttttctgactccaattgtgctttcattttcttggggaccaatg |
2145491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University