View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3103_low_76 (Length: 202)
Name: NF3103_low_76
Description: NF3103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3103_low_76 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 76 - 179
Target Start/End: Original strand, 20641254 - 20641357
Alignment:
| Q |
76 |
gaatgaagaagttttcatgaaaatgcctcctggtttttctgtttctcaaccagacatggtttgcaaattacgaaaatcactttatggcttaaaacaagct |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20641254 |
gaatgaagaagttttcatgaaaatgcctcctggtttttctgtttctcaaccagacatggtttgcaaattacgaaaatcactttatggcttaaaacaagct |
20641353 |
T |
|
| Q |
176 |
ccgc |
179 |
Q |
| |
|
|||| |
|
|
| T |
20641354 |
ccgc |
20641357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 41 - 177
Target Start/End: Original strand, 33158938 - 33159074
Alignment:
| Q |
41 |
atggatgtgcacaatgcgtttctacatggagatctgaatgaagaagttttcatgaaaatgcctcctggtttttctgtttctcaaccagacatggtttgca |
140 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| || | || ||||| || ||||||||||||||||||||||| | || |||||| ||| || |||| |
|
|
| T |
33158938 |
atggatgtgcacaacgcctttctacatggagatttgcacgaggaagtctttatgaaaatgcctcctggtttttcaatatcacaaccaaacacagtctgca |
33159037 |
T |
|
| Q |
141 |
aattacgaaaatcactttatggcttaaaacaagctcc |
177 |
Q |
| |
|
| | || |||||||| ||||| |||||||||||||| |
|
|
| T |
33159038 |
agcttcgcaaatcactctatgggttaaaacaagctcc |
33159074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University