View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3104_high_16 (Length: 228)
Name: NF3104_high_16
Description: NF3104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3104_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 11 - 208
Target Start/End: Complemental strand, 40514774 - 40514577
Alignment:
| Q |
11 |
atcatcacgaaagacctaagacagctttggtgtttgccttaaatataacaataaccatgtgccgtgagtgtcaatgccaaatattgtgaagtgatatgtc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40514774 |
atcatcacgaaagacctaagacagctttggtgtttgccttaaatataacaataaccatgtgccgtgagtgtcaatgccaaatattgtgaagtgatatgtc |
40514675 |
T |
|
| Q |
111 |
ggcaataacttacatagagtggattctaaccaaacagcacttaaaatgatcatataacccacaaataatattggaatttgatttaattagcatgcgta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40514674 |
ggcaataacttacatagagtggattctaaccaaacagcacttaaaatgatcatataacccacaaataatattggaatttgatttaattagcatgcgta |
40514577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University