View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3104_high_7 (Length: 383)
Name: NF3104_high_7
Description: NF3104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3104_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 49 - 376
Target Start/End: Complemental strand, 8796252 - 8795925
Alignment:
| Q |
49 |
ttcttaattagtctttttcaataatattttatattgctagcttgtactctttttaatcttctttgcctaaataagtgagttcctaatacttgctaccaaa |
148 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8796252 |
ttcttaattagtctttttcaatagtattttatattgctagcttgtactctttttaatcttctttgcctaaataagtgagttcctaatacttgctaccaaa |
8796153 |
T |
 |
| Q |
149 |
ggtgcccttaactcatgcgttttttgtctaaaaataaaggtagatggtgatgtatagtagtacatatatatttcattggtgttggtgcattgaaggaact |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8796152 |
ggtgcccttaactcatgcgttttttgtctaaaaataaaggtagatggtgatgtatagtagtacatatatatttcattggtgttggtgcattgaaggaact |
8796053 |
T |
 |
| Q |
249 |
taactatataggtatcttgttaaattcgtcttttcttttgtgtgtgcttgatagtattgtttttatgggaactataagacttgcatcatcacacatatag |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8796052 |
taactatataggtatcttgttaaattcgtcttttcttgtgtgtgtgcttgatagtattgtttttatgggaactataagacttgcatcatcacacatatag |
8795953 |
T |
 |
| Q |
349 |
ctttttcttaaaatttcccttttgatga |
376 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
8795952 |
ctttttcttaaaatttcccttttgatga |
8795925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University