View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3104_low_13 (Length: 336)
Name: NF3104_low_13
Description: NF3104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3104_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 23 - 179
Target Start/End: Complemental strand, 28879282 - 28879126
Alignment:
| Q |
23 |
tgttgtaaggtttaacacactagatgcatgtgactccatttaattcagatttcttcactttactttcattccctatactattgttacaattttccttttc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28879282 |
tgttgtaaggtttaacacactagatgcatgtgactccatttaattcagatttcttcactttactttcattccctatactattgttacaattttctttttc |
28879183 |
T |
|
| Q |
123 |
catttaaggcaagcttttgaaaaatttctcatttaacactataggtctgtagtatca |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28879182 |
catttaaggcaagcttttgaaaaatttctcatttaacactataggtctgtagtatca |
28879126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 204 - 267
Target Start/End: Complemental strand, 28879106 - 28879043
Alignment:
| Q |
204 |
cctatatcaatgacatcaaattggtctaattgaagtttaaacaatattgtacctcaagaataga |
267 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28879106 |
cctatatcaatgacatcaaattggtctaaatgaagtttaaacaatattgtacctcaagaataga |
28879043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University